During translation, the growing peptide chain resides in the P site of rRNA withthe next amino acid in the chain waiting in the A site. Erythromycin, a commonantibiotic, prevents the TRNA at the A site from moving into the P site. How doesthis result in the death of the bacteria? *O This terminates the replication of DNA.This prevents the translation of proteins necessary for life.O This prevents the generation of RNA from DNA.O This creates a breakdown in metabolism, resulting in starvation of the bacteria.

Name: During translation, the growing peptide chain resides in the P site o
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: During translation, the growing peptide chain resides in the P site of rRNA withthe next amino acid in the chain waiting in the A site. Erythromycin, a commonantibiotic, prevents the TRNA at the A site from moving into the P site. How doesthis resul

Answer: CENTRAL DOGMA = This is the basic mechanism by which DNA is replicate and transcript in the…

Science

Biology

During translation, the growing peptide chain resides in the P site of FRNA with the next amino acid in the chain waiting in the A site. Erythromycin, a common antibiotic, prevents the tRNA at the A site from moving into the P site. How does this result in the death of the bacteria? *

During translation, the growing peptide chain resides in the P site of FRNA with the next amino acid in the chain waiting in the A site. Erythromycin, a common antibiotic, prevents the tRNA at the A site from moving into the P site. How does this result in the death of the bacteria? *

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
The tRNA for Phe binds to the mRNA codon UUU. You mutate the anticodon of the Phe-tRNA from AAA to GAA. What happens to the cell? Select the best answer. Please note that all nucleic acid sequences are provided according to scientific convention. a. All UUU codons now code for Glu instead of Phe b. All UUU codons now code for Leu instead of Phe c. Nothing happens d. All AAA codons now code for Glu instead of Phe e. All AAA codons now code for Leu instead of Phe
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
Which of the following statements best describes the initiation of translation? A) The large and small ribosomal subunits scan the mRNA in the 3'–5' direction until the promoter is reached. B) A tRNA with the anticodon, AUG, enters the ribosomal complex and binds to the mRNA at the A site. C) The mRNA containing the start codon, AUG, sits at the P site and forms a complex with the corresponding tRNA, and the large and small ribosomal subunits. D) The mRNA attaches to the large ribosomal subunit and once the start codon reaches the A site, the tRNA binds and the small subunit completes the complex.
A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)
what is the first event to take place in translation in eukaryotic cell? a. An clongation of the polypeptide chain by the addition of amino acids b. Binding of the larger ribosomal subunits to the smaller ribosomal subunits c. Base pairing of activated methionine-tRNA to AUG of messenger RNA d. The small subunits of ribosome recognizing and attaching to 5' cap of mRNA
The piece of RNA below includes the region that codes for the binding site for the initiator tRNA needed in translation. 5′-GUUUCCCGUAUACAUGCGUGCCGGGGGC-3′ Which amino acid will be on the tRNA that is the first to bind to the A site of the ribosome? A) methionine B) arginineC) cysteine D) valine
What would be the direct consequence to a cell of loss-of-function of Elongation Factor-Tu (EF-Tu)? You may select multiple answers. a. tRNAs would fail to exit the E site after giving up their amino acid. b. The error rate of translation would increase. c. The ribosome would frequently fail to identify the correct start codon and initiation of translation would become less efficient. d. There would be no pause between the entry of a tRNA into the A site and peptidyl transfer.
Not all proteins are made from the RNA genome ofbacteriophage MS2 in the same amounts. Can you explainwhy? One of the proteins functions very much like a repressor,but it functions at the translational level. Which protein is itand how does it function?
Arrange the processes involved from Transcription to Translation. 1 2 3 4 5 6 7 8 9 10 11 Translocation RNA polymerase binds in the promoter regions Elongation of RNA transcript Polypeptide cleavage DNA rejoins Partial unwinding of DNA Attachment of the mRNA to ribosome with AUG in the P site Binding of Rho factor Appearance of UAG codon Covalent bonding of AA to the tRNA Release of methionine and conversion to active protein
The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start codon, what is the third amino acid incorporated into the polypeptide chain?
The ribosome is the target for many important antibiotics. Distinct antibiotics inhibit various steps in the translation process. Please specify which step of the translation (one short sentence is sufficient) each antibiotic below targets (ex: kasugamycin – inhibits formation of the initiation complex) a) chloramphenicol b) tetracycline c) erythromycin d) aminoglycosides such as kanamycin