
Database System Concepts
7th Edition
ISBN: 9780078022159
Author: Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
- Design the logic (flowchart and/or pseudocode) using arrays for a program. It asks a user to enter a product number, then searches through an existing list of product numbers, for each one of which a recall has been issued recently. Based on the search result, a message will be displayed to the user (e.g., "A recall has been issued for this product." or "No recall found for this product."). Here is the existing list of product numbers: 100, 103, 108, 110, and 125.
PreviousNext
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 3 steps with 1 images

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- Complete the following Codearrow_forwardComplete the function that calculates the sum of the first n+1 terms of the geometric series a, ar, ar² ar³, arª ….. arn Note that the series begins with a and the last term is ar", in total there are n+1 terms. 1: # complete the function given the #variables a,r,n and return the value as series_sum. def sum geometric_series(a,r,n): # YOUR CODE HERE return series_sum print (sum_geometric_series (4.0, 5, 10))arrow_forwardCustomized step counter Learning Objectives In this lab, you will Create a function to match the specifications Use floating-point value division Instructions A pedometer treats walking 2,000 steps as walking 1 mile. It assumes that one step is a bit over 18 inches (1 mile = 36630 inches, so the pedometers assume that one step should be 18.315 inches). Let's customize this calculation to account for the size of our stride. Write a program whose input is the number of steps and the length of the step in inches, and whose output is the miles walked. Output each floating-point value with two digits after the decimal point, which can be achieved as follows: print(f'{your_value:.2f}') Ex: If the input is: 5345 18.315 the output is: You walked 5345 steps which are about 2.67 miles. Your program must define and call the following function. The function should return the number of miles walked.def steps_to_miles(user_steps, step_length) # Define your function here if __name__…arrow_forward
- : Animating a Plot Problem: The MATLAB code with the initial conditions and one dimensional motion equation are given in the MProject2_Assignment1_base.m file. Modify the code to explore how to animate the plot, use functions to create plot functionarrow_forwardPlease written by computer source (java)arrow_forwardPython elif ifarrow_forward
- Create a c programming flowgorithm chart for the following: You must use at least two different arrays A character array to store the welcome message (note: when creating your flowchart you will need to declare this message with the string data type as a variable and assign the message). Use the puts() function to display the message to the screen. An array with a float datatype to store the prices of the items Prompt the user to enter how many items they have to total. Use a for() statement to fill the array using the value the user entered as the end point of the loop. Use an accumulating total statement to compute the total sales There is a constraint - if the price of any one item is greater than $10.00 it is considered invalid, you must use a repetitive statement to display a message and force the user to enter a value less than $10.00 You need to create a function to compute the final total using a sales tax of 6% (.06)arrow_forwardLooping Construct with Floating Point Numbers Write a program that utilizes a while-loop to read a set of five floating-point values from user input. Include code to prevent an endless loop. Ask the user to enter the values, then print the following data: Total Average Maximum Minimum Interest on total at 20% Answer:arrow_forwardDesign the logic for a program either by pseudocode or flowchart that allows the user to enter a maximum of 10 numbers. If the use enters a -1 the input loop stops early. The value -1 is not data but a quit(sentinel) flag value that is not entered into the array. Then, the program displays the count of the numbers entered and numeric average of the numbers (not including the -1 of course). After display the average of all the entered numbers, the program will then display each number and its difference from that average.arrow_forward
- C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forwardCoin Toss Write a function named coinToss that simulates the tossing of a coin. When you call the function, it should generate a random number in the range of 1 through 2. If the random number is 1, the function should display "heads". If the random number is 2, the function should display "tails". Demonstrate the function in a program that sks the user how many times the coin should be tossed and the coin then simulates the tossing of the coin that number of times.arrow_forwardpython module must define four functions:a. add(a, b)b. subtract(a, b)c. multiply(a, b)d. divide(a, b)i. Divide must check for division by zero and return an error message if itencounters it.3. Each function should take two arguments and perform the corresponding mathematicaloperation. Return the result, don’t print it in the function.4. Include a main() function that tests these functions with some example inputs. Ensurethat you print the results of the function calls here in the main function and provide theappropriate labels.5. The main() function must only run automatically if the module is being run directly, notwhen imported.arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Database System ConceptsComputer ScienceISBN:9780078022159Author:Abraham Silberschatz Professor, Henry F. Korth, S. SudarshanPublisher:McGraw-Hill EducationStarting Out with Python (4th Edition)Computer ScienceISBN:9780134444321Author:Tony GaddisPublisher:PEARSONDigital Fundamentals (11th Edition)Computer ScienceISBN:9780132737968Author:Thomas L. FloydPublisher:PEARSON
- C How to Program (8th Edition)Computer ScienceISBN:9780133976892Author:Paul J. Deitel, Harvey DeitelPublisher:PEARSONDatabase Systems: Design, Implementation, & Manag...Computer ScienceISBN:9781337627900Author:Carlos Coronel, Steven MorrisPublisher:Cengage LearningProgrammable Logic ControllersComputer ScienceISBN:9780073373843Author:Frank D. PetruzellaPublisher:McGraw-Hill Education

Database System Concepts
Computer Science
ISBN:9780078022159
Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher:McGraw-Hill Education

Starting Out with Python (4th Edition)
Computer Science
ISBN:9780134444321
Author:Tony Gaddis
Publisher:PEARSON

Digital Fundamentals (11th Edition)
Computer Science
ISBN:9780132737968
Author:Thomas L. Floyd
Publisher:PEARSON

C How to Program (8th Edition)
Computer Science
ISBN:9780133976892
Author:Paul J. Deitel, Harvey Deitel
Publisher:PEARSON

Database Systems: Design, Implementation, & Manag...
Computer Science
ISBN:9781337627900
Author:Carlos Coronel, Steven Morris
Publisher:Cengage Learning

Programmable Logic Controllers
Computer Science
ISBN:9780073373843
Author:Frank D. Petruzella
Publisher:McGraw-Hill Education