Explain this krebs cycle
Q: Which of the following translocases serves as the central entry gate for cytosolic precursor…
A: A newly synthesized protein in the cytoplasm is transported into the target site through a process…
Q: True or false 1. Heterogenous antibodies used for structural studies can be obtained by monoclonal…
A: Heterogenous antibodies - Heterogenous terms indicates that the molecule is a hybrid. i.e. a single…
Q: Provide other techniques which can be used to characterize DNA extracts. Provide advantages and…
A: DNA extracts characterization is done by many methods. It is done to check purity, stability,…
Q: Which of the following fat-soluble vitamins would test positive for the Baeyer's test? Stapanan…
A: Baeyers test is a test for unsaturation. Baeyers reagent consists of cold alkaline KMnO4. It gives…
Q: B. Below is a short segment of a DNA molecule. Translate the DNA codon into mRNA. Use your data…
A: DNA conists of a double-stranded helix wound together by weak hydrogen bonds between…
Q: What is the main source of energy for ATP replenishment for ATP-PC system
A: ATP is produced by either substrate-level phosphorylation or oxidative phosphorylation Hydrolysis of…
Q: If you want to make 7 L of 1X TGS (Tris/Glycine/SDS Running Buffer) using 8 x TGS stock, how much of…
A: Recall the equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock…
Q: Which of the following best describes the function of high energy phosphate compounds in metabolism?…
A: Phosphate compounds seen in lifeforms can be broadly divided into low energy and high energy…
Q: he human body requires various nutrients which are essential for health and can be obtained from a…
A: Proteins are comprised of amino acids polymer linked by peptide/amide bonds. Fats are insoluble…
Q: 4. What are the ABSORBABLE units of EACH of the FOUR Biological Molecules (Macromolecules) called?…
A: Macromolecules are large complex molecules which is formed from the polymerization of thousand of…
Q: This graph represents a standard curve from a BCA assay for protein concentration. If your BCA…
A: Standard curve can be constructed by using the known concentrations of a sample and their…
Q: 1. 2. 3. Why does casein precipitates upon the addition of acetic acid? Why is milk used as an…
A: 1. Casein is stable in a solution, at pH values close to 7. This is because at this pH casein…
Q: Passage 1 (Questions 1-4) Human immunodeficiency virus 1 (HIV-1) protease inhibitors have been…
A: Answer 2 The Bose-Einstein Principle -Bose-Einstein condensate is a group of atoms cooled to within…
Q: Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ What is the…
A: The proteins are constituted of twenty naturally occurring amino acids. Each amino acid is encoded…
Q: The question stated the standard free energy change not the actual free energy change. You solved…
A: Standards free energy change calculated at biochemical standards is called biochemical standard free…
Q: During phototransduction, the molecular processing in retinal rods under light activates mechanism…
A: Cells become polarized through a process called polarization, which involves the localization of…
Q: ATP is the primary source of cellular energy. What qualities of ATP make it a useful energy…
A: ATP acts as the “energy currency” of the cell. The energy that is released during fuel oxidation in…
Q: 2. Energetics of the electron transport. In the oxidative phase of oxidative phosphorylation,…
A: Standard change in Gibbs free energy (∆G'0 ) of redox reactions can be found, if we know the…
Q: The glycolytic enzyme aldolase catalyzes the following cleavage reaction: Fructose 1,6-bisphosphate…
A: Aldolase is an enzyme that catalyses one of the reaction of glycolytic pathway by performing a…
Q: Certain proteins undergo Post Translational Modifications (PTMs) with lipid derivatives such as…
A: Post-translational modification Post-translational modification is a process by which proteins are…
Q: Write schematically the synthesis of phosphatidylethanolamine through the activation of amino…
A: INTRODUCTION : Phospholipids : They are a group of biochemical compounds which are made up of fatty…
Q: TRUE OR FALSE 1. Rotational entropy is the freedom to move in three-dimensions. 2. Vitamin B1…
A: In the cellular environment, the condition do not allow biochemical reactions to occur at…
Q: ATP + H₂0 ➜ ADP + Pi 3Na+ (inside) + 2K+ (outside) AG = -30.5kJ/mol + ATP4 + H₂O → 3Na* (outside) +…
A: Gibbs's free energy, known as free energy or G, is a thermodynamic quantity that represents the…
Q: A Moving to anothe estion 18 Articular cartilage has little to no self-healing ability. It is…
A: It is also called as hyaline cartilage. It is firm but slightly elastic or flexible cartilage of…
Q: Why was it necessary to use phosphoaminophosphonic acid-adenylate ester (ANP) in the ATP synthase…
A: As per the chemiosmotic Model, ATP synthase is the enzyme that phosphorylates ADP with Pi as…
Q: Cholera is an acute, diarrheal disease caused by infection of the intestine with the gram-negative,…
A: Proteins are high molecular weight biomolecules made up of amino acid residues linked via peptide…
Q: he initial velocity data shown in the table were obtained for an enzyme. Each assay at the…
A: Michaelis-Menten described the relationship between reaction velocity and substrate concentration.…
Q: (d) NH + (a) CH₂ CH₂ (b) O-H-- CH H-C CH₂ CH3 CH₂COOH H H CH₁ CH, (c) 5 5 (b) CH₂ CH₂ CH₂ CH CH (d)…
A: Proteins are the macro molecules that show diversity in their structure by possessing four levels of…
Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…
A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…
Q: What is ATP? Explain in two sentences. 2. How is ATP produce in Glycolysis? Kreb Cycle? Electron…
A: Individual cells release energy through the process of cellular respiration, which involves the…
Q: Sugar Molisch's Solution Test Glucose Sucrose Lactose Hydrolysis: Samples Sucrose hydrolysate Starch…
A: Glucose , sucrose, lactose, starch all are carbohydrates. Glucose is the simplest carbohydrate of…
Q: DNA Extraction and Characterization from Shrimp Describe the resulting gel, assess the purity of…
A: Here, given is a picture of sample gel. The distance of migration of bands in the ladder is given in…
Q: Which energy system did you use for a vertical one-clap pushup or pushup? (Choose one) A) ATP-PC…
A: Answer ATP-PC system Explanation The ATP-PC system, also known as the phosphagen system, is the…
Q: Question 22 Each GroEL subunit has an ATP-binding pocket that catalyzes hydrolysis of its bound ATP…
A: GroEL-ES is a molecular chaperone complex assit in folding of cellular proteins. GroEL is composed…
Q: What is the role of protist in metabolism?
A: Metabolism is the process in which food or nutrition is converted into energy by the body of an…
Q: Experimental results describing a protein's amino acid composition are useful for estimating the…
A: Proteins are high molecular weight polymers of amino acid residues linked together via peptide…
Q: describe the principal reactant and products of major steps of glucose oxidation
A: Three distinct metabolic pathways are involved in cellular respiration, which is where glucose…
Q: which of these describes the symptoms of the disease(s) caused by mutations in this gene…
A: Mutation in the following gene i.e. XPA gene, causes malfunctioning of DNA repair mechanisms of our…
Q: Provide a simple sketch of the covalent intermediate likely to form between active site serine…
A: Serine, histidine, and aspartate all are amino acids. They all have different properties and…
Q: What charge at pencentage of the Histidane side chain will PH = 7₁4? Cerrry No.
A: His is basic polar amino acids and His contains imidazole as side chain group. pKa of His is 6. pH…
Q: To completely reduce an oxidized cytochrome-c, how many electrons are required?
A: The electrons transport chain is a collection of four protein complexes: complex I, II, III and IV…
Q: Which of the following is NOT a secondary database for structural classification of proteins?…
A: Proteins are polymers of amino acid that have five functional role. Protein databases are…
Q: ~0.766+ 47425 y-0.568x46576 . . . . . X The inhibitor binds at the active site. The inhibitor binds…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Paper electrophoresis of Asn, Ala, Asp, Lys and Ser mixtures at pH = 7 shows the fastest movement…
A: Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: Although as a whole, metabolic pathways are thermodynamically favorable, there’s at least one…
A: The Delta G of a reaction can be calculated as follows. Delta G = Delta G0 + RTln(Q) Where R =…
Q: Prepare a schematic diagram and present it. The Figure should illustrate the interactions made…
A: Binding of drug to receptor or protein can be specific and non-specific. For the genuity of the…
Q: What product is formed in the committed step of the biosynthesis of pyrimidines? O a. pyrophosphate…
A: Pyrimidine biosynthesis happens in the cytoplasm with six steps process and it is synthesized from a…
Q: Calculate θ for a certain protein-ligand pair when the ligand concentration = 1 M and the Kd = 1 X…
A: The core of biology is molecular connections. Two molecules, such as a ligand and a receptor, must…
Q: ) Describe the 10 enzymatic reactions of glycolysis and the organization of the pathway in 2 main…
A: Glycolysis is a metabolic pathway during which glucose molecule splits into pyruvate molecules with…
Q: tate and define the four levels of protein structure, also include the bonds found at each level?
A: Introduction Proteins are the most abundant macromolecules in our body. Proteins are made up of…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A Deficiency on 3-Phosphogtycerate Dehydrogenase Can Affect Amino Acid Metabolism Although serine is a nonessential amino acid, serine deficiency syndrome has been observed in humans. One such form of the syndrome is traceable to a deficiency in 3-phosphoglycerate dehydrogenase (see Figure 25.31). Individuals with this syndrome not only arc serine-deficient but also arc impaired in their ability to synthesize another common ammo acid, as well as a class of lipids. Describe why.Assume that all carbon atoms and nitrogen atoms in both alanine and aspartate are labelledwith radioisotopes. Then, the radioisotope-labelled alanine and aspartate molecules areallowed to undergo metabolism in the liver. All carbon atoms and nitrogen atoms in both ureaand glutamine are found to be labelled with radioisotopes. Please write down the metabolicreactions that lead to the incorporation of radioisotope-labelled carbon and nitrogen atoms intourea and glutamine.Consider the each of the amino acids in the peptide below. Ala-Ile-Asp-Arg-Gln-Gly-Pro-Gly-Ala-Tyr-Val-Ile-Gln-Leu If all of the amino acids are degraded to yield energy (ATP), explain how many Acetyl CoAs for oxidation to CO2 could be produced from this peptide. note: Do not make glucose at the beginning, however converting the TCA intermediates into molecules in the glycolytic pathway for optimal Acetyl CoA production is allowed. Be sure to show clearly which pathway will the Acetyl CoA enter (to yield ATP ultimately) under such condition
- A. Elastase is activated by trypsinB. Trypsinisactivatedbyelastase Which statement is correct? Proteolytic activation of chymotrypsin from chymotrypsinogen requires cleavage of four peptide bonds. Assume that any proteases can convert 100 substrates to 100 products. Activation of one enteropeptidase can eventually lead to formation of how many chymotrypsin proteins?What is the final enzyme used in the biosynthesis of stearate (C18:0)? A. Elongase B.Beta-Ketoacyl- ACP Synthase C. Beta-Ketoacyl- ACP Dehydrase D. Palmitoyl thioesterase E. Malonyl-CoA ACP Transacylase F. Enoyl-ACP ReductaseThere are eighteen (18) rows of boxes, for around 36-38 boxes total. Please see images attached. This is a pathway trace, with the final box showing "ribose 5 phosphate" as the end product. Any help is appreciated-thank you! glutamate to ribose 5 phosphate No a ketoglutarate dehydrogenase No pyruvate carboxylase No transketolase No transaminase You do get to have if needed: erythrose 4 phosphate asparate dihydroxyacetone phosphate bicarbonate ATP ornithine CO2
- Define the following terms:a. homoglycanb. heteroglycanc. amylosed. amylopectine. enterocyteNonalcoholic fatty liver disease is thought to be exacerbated by a diet heavy in sugar. Explain?What is(are) the only active site(s) not used in the second round of fatty acid synthase? Select all that apply. Group of answer choices Acetyl-CoA ACP Transacylase Beta-Ketoacyl- ACP Synthase Beta-Ketoacyl- ACP Dehydrase Palmitoyl thioesterase Malonyl-CoA ACP Transacylase Enoyl-ACP Reductase
- Von Gierke’s disease is also known as glycogen storage disease type I. Patients with von Gierke’s disease lackglucose 6-phosphatase activity. Two prominent symptoms of this disorder are fasting hypoglycemia and lactic acidosis (elevated lactate levels in the blood), especially during strenuous exercise. Explain why these symptoms occur. What chemical reaction does this enzyme catalyze? Which pathways involve this enzyme? Lacking thisthe enzyme will cause impairment of which pathways?• Pls consider what pathways are affected by Von Gierke’s disease. Include in your explanation involving Cori’s cycle. can you please do not write by your hand? I mean computer if you can. thank youWhat is(are) the only active site(s) not used in the second round of fatty acid synthase? Select all that apply. Acetyl-CoA ACP Transacylase Beta-Ketoacyl- ACP Synthase Beta-Ketoacyl- ACP Dehydrase Palmitoyl thioesterase Malonyl-CoA ACP Transacylase Enoyl-ACP ReductaseDysregulation of glutamate dehydrogenase (GDH), an enzyme that catalyzes the oxidative deamination of glutamate, leads to a variety of metabolic and neurological disorders. One such disorder is hyperinsulinism/hyperammonemia syndrome. 1. Describe the role of GDH including the structure, function and biochemistry of the protein and its contribution to the disease. 2. Discuss the several ways that this disease can be diagnosed in the lab 3. Discuss the mechanism by which pharmacological agents act to help in the management of the disease.
