Below is a picture of a single origin of replication in a eukaryotic cell. 5' 37 5' 1. On the figure above, Draw out where the following molecules will be located: Helicase; Sliding Clamp, Single Strand Binding Protein. 2. On the right hand side of the dotted line, the replication of which template strand (top or bottom) will be continuous by DNA polymerase? 3. On the left hand side of the dotted line, the complete replication of which template strand (top or bottom) will be more affected by a mutation that causes DNA ligase to be partially functional?

Below is a picture of a single origin of replication in a eukaryotic cell. 5' 37 5' 1. On the figure above, Draw out where the following molecules will be located: Helicase; Sliding Clamp, Single Strand Binding Protein. 2. On the right hand side of the dotted line, the replication of which template strand (top or bottom) will be continuous by DNA polymerase? 3. On the left hand side of the dotted line, the complete replication of which template strand (top or bottom) will be more affected by a mutation that causes DNA ligase to be partially functional?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 23QP: How does DNA replication occur in a precise manner to ensure that identical genetic information is...

See similar textbooks

Similar questions

How does DNA replication occur in a precise manner to ensure that identical genetic information is put into the new chromatid? See Figures 8.12 and 8.13. FIGURE 8.12 In DNA replication, the two polynucleotide strands uncoil, and each is a template for synthesizing a new strand. A replicated DNA molecule contains one new strand and one old strand. This mechanism is called semiconservative replication. FIGURE 8.13 A close-up look at the process of DNA replication. (a) As the strands uncoil, bases are added to the newly synthesized strand by complementary base pairing with bases in the template strand. The new bases are linked together by DNA polymerase. (b) DNA synthesis can proceed only in the 5 3 direction; newly synthesized DNA on one template strand is made in short segments and linked together by the enzyme DNA ligase.
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side
Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "A"? to separate the double helix into two to piece together the Okazaki segments to copy the new DNA strand to the old strand by complementary base pairing Using the figure below, what is molecule "G" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "G"? to separate the double helix into two to piece
Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "A"? to separate the double helix into two to piece together the Okazaki segments to copy the new DNA strand to the old strand by complementary base pairing Using the figure below, what is molecule "G" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "G"? to separate the double helix into two to piece together the Okazaki segments to copy the new DNA strand to the old strand by complementary base pairing Which of the following statements best describes why one of the daughter strands is synthesized in pieces? the enzymes that synthesize DNA are slower that the enzymes that unwind the double helix and this produces 'lagging time' the enzymes that synthesize DNA can only do so in a 5' --->3' direction this figure illustrates a eukaryotic cell since prokaryotic cells do not synthesize DNA…
A scientist successfully analyzed a new micro-organism. Because this micro-organism contains double-stranded DNA as genetic material, Meselson-Stahl techniques was employed. The following shows the results of the experiment where L – light chain (14N) and H – heavy chain (15N).What is the mechanism of replication in this organism in the picture? Explain how you got the answer. The following piece of DNA is sequenced using the dideoxy method: 3’-AAGCGGCTAATCC-5’. Accidentally, you forget to include dATP in the four reactions that contain a ddNTP. What is the sequence of the daughter strand produced from this sequencing activity? Show the process. The following piece of DNA is sequenced using the dideoxy method: 3’-AAGCGGCTAATCC-5’. Accidentally, you forget to include dATP in the four reactions that contain a ddNTP. How many bands will appear in the lane containing ddATP? Show the process. The following piece of DNA is sequenced using the dideoxy method: 3’-AAGCGGCTAATCC-5’.…
For the template DNA below, which includes one labeled end of the template DNA, clearly label the following: The origin of replication The most recently added base on each strand you draw for b & c, marked with an asterisk (star). Where DNA helicase would be & direction it moves. Where DNA ligase will be needed after replication is complete.
1 2 3 4 5 6 7 8 9 The gaps between the DNA fragments are sealed by DNA ligase Elongation of both the lagging and the leading strand Topoisomerase binds at the region ahead of the replication fork Primase synthesizes RNA primers RNA primers are removed and gaps are filled by DNA pol I DNA unwinds at the origin of replication DNA polymerase III starts adding nucleotides Helicase opens up the DNA-forming replication forks Single-strand binding proteins coat the DNA Arrange the processes involved in DNA replication
Which of the following most correctly describes a process that occurs during DNA replication? Group of answer choices Replication of the lagging strand occurs in the 5' → 3' direction—the leading strand in the 3' → 5' direction. Replication is continuous on the lagging strand and discontinuous on the leading strand. Okazaki fragments are DNA fragments synthesized on the lagging strand. DNA polymerase adds dNTP monomers in the 3′–5′ direction. Replication is continuous on the lagging strand and discontinuous on the leading strand.
In Semi conservative replication: A. After one round of replication of a single molecule of DNA, one DNA molecule will be produced that contains two parental strands of DNA and one DNA molecule will be produced that contains two new (or de novo) strands. B. After one round of replication of a single molecule of DNA, two resulting DNA molecules will be produced both of which contain a mix of both parental and new DNA interspersed on every strand of DNA C. After two rounds of replication of a single molecule of DNA, two resulting DNA molecules will contain both a parental strand and a new strand of DNA and the other two resulting DNA molecules will contain all new (or de novo) DNA D. After two rounds of replication of a single molecule of DNA, one resulting DNA molecule will contain 2 parental strands of DNA and the other three resulting DNA molecules will contain all new (or de novo) DNA E. A and C F. B and D
A gene encoding one of the proteins involved in dna replication has been inactivated by a mutation in a cell. in the absence of this protein, the cell attempts to replicate its dna. What would happen during the dna replication process if each of the following proteins were missing?a. DNA polymerase B. DNA ligasec. Sliding clamp for DNA polymerased. nuclease that removes RNA primerse. DNA helicase F. primase
You figure out a way to replicate DNA in a test tube by adding double-stranded DNA template, dNTPs, NTPs and all the proteins needed for replication. However, you forget to add DNA ligase. In a well-labelled diagram, fill in the following parts of the growing replication fork shown. 1) Fill in any replicated nucleic acids, using at least 2 Okazaki fragments where appropriate, Label the new strands as “leading” or “lagging”, Label the 5’ and 3’ ends of all nucleic acid strands that you draw, Draw a circle representing the location of DNA helicase (do not include any other proteins in your drawing)
Match each protein involved in DNA replication with its correct function in E. coli. An answer can be used more than once. Group of answer choices The major DNA replicating enzyme on both leading and lagging strands Relieves torsional stress upstream of replication forks Unwinds the double helix at replication forks Provides DNA polymerase III with a 3'-OH group paired with a DNA template Extends lagging strands at the ends of linear chromosomes Digests RNA…