Genome Assembly with Perfect Coverage and Repeats Given a list of error-free DNA 3-mers taken from the same strand of a circular chromosome. Find all circular strings assembled by complete cycles in the de Bruijn graph B2. Find the circular chromosome sequence. Dataset: ATC ATG CAT CCA GAT GGA TCC TGG

Genome Assembly with Perfect Coverage and Repeats Given a list of error-free DNA 3-mers taken from the same strand of a circular chromosome. Find all circular strings assembled by complete cycles in the de Bruijn graph B2. Find the circular chromosome sequence. Dataset: ATC ATG CAT CCA GAT GGA TCC TGG

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 4P: Multiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram...

See similar textbooks

Similar questions

a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
DNA polymerase functions from 5’ to 3’ direction. Explain this sentence. Youmay use a figure to aid your explanation.
Give only typing answer with explanation and conclusion Your analysis has identified that this new organism has same chromosomal structure as that of eukaryotes on earth. However, the average length of linker DNA of the new organism is 100 bp. If the haploid genome of the new organism has a size 6 billion bp, how many nucleosomes will be in this new organism?
Some chromatin remodeling factors use energy from ATP hydrolysis to slide nucleosomes.shifting nucleosome position on the DNA. true/false
TOPIC : GENETICS - Answer D, E, F only - see the answer for A, B, C in thr other image, base you answer in the given example! Give and EXAMPLE of each genetic term to tell the difference of the terminplogies. NOT MEANING!
Three DNA molecules (DNA1: ATATAT; DNA2: ATCGAT, DNA3: CGCGCG) were separated by DNA denaturation experiment. Please draw the DNA denaturation (DNA melting) curves corresponding to the three molecules and annotate X and Y axis.
Human Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second in human cells and origins of replication occur every 300 kbp. Assume also that human DNA polymerases are highly processive and only two molecules of DNA polymerase arc needed per replication fork. How long would it take to replicate the entire diploid human genome? How many molecules of DNA polymerase does each cell need to carry out this task?
Number of Okazaki Fragments in E. coli and Human DNA Replication Approximately how many Okazaki fragments are synthesized in the course of replicating an E. coli chromosome? How many in replicating an â€œaverageâ€� human chromosome?
DNA Profiles as Tools for Identification A PCR-based paternity test is conducted using STRs that consistently produce a unique DNA fragment pattern from a single chromosome. Examining the results of the following Southern blot, which male(s) can be excluded as the father of the child? Which male(s) could be the father of the child?
Multiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram illustrating replication of the circular E. coli chromosome (a) at an early stage, (b) when one-third completed, (c) when two-thirds completed, and (d) when almost finished, assuming the initiation of replication at oriC has occurred only once. Then, draw a diagram showing the E. coli chromosome in problem 3 where the E. coli cell is dividing every 20 minutes.
Please answer both question.its all a one question.otherwise I will give downvote. Below is a double strand DNA sequence contain a gene and it will go under transcription, suppose that the 3/ → 5/ is the template strand: 3/-TAC-GAC-CGT-TGG-CTT-CTG-TGT-AGG-TAT-ACC-GAT-ACT-5/ 5-/ATG-CTG- GCA-ACC-GAA-GAC-ACA-TCC-ATA-TGG-CTA-TGA-3/ 1- Write down the mRNA transcript with direction of ends of the strand? 2- Construct the resulted polypeptide chain from translation of the mRNA above based on the following codons translation below AUG: Methionine GCA: Alanine ACC: Threonine UGA: write its name GAA: Glutamic acid GAC: Aspartic acid CUG: Leucine ACA: Threonine UCC: Serine AUA: Isoleucine UGG: Tryptophan CUA: Leucine
Which statements are true? Explain why or why not.1 Because the DNA double helix is only 2 nm wide—well below the limit of resolution of the light microscope—it is impossible to see chromosomes in living cells withoutspecial stains.2 A fluorescent molecule, having absorbed a singlephoton of light at one wavelength, always emits it at a longer wavelength.