Answered: 34. Give the sequence of the…

34. Give the sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’-TATGGCATAC-3’

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 25CTQ: Describe the structure and complementary base pairing of DNA.

See similar textbooks

Related questions

Q: The following represents a DNA strand in the process of replication. The bottom sequence is that of…

A: DNA replication is the process in which a copy of already existing genome is formed. A pair with T…

Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT…

A: DNA polymer: 3'- CAG TTA AGG CTC CTA GGT TA - 5' a) first 5 bases at the 3' end of the…

Q: SOURCE: GENERAL, ORGANIC AND BIOLOGICAL CHEMISTRY by Smith 4th Edition

A: DNA is the genetic material that carries genetic material in the form of coded nucleotide sequences.…

Q: 1. If 30% of DNA is Adenine, what percent is Thymine?

A: DNA ka double helical structure that consists of sugar phosphate and bases. the sugar that is…

Q: 13. What is the complimentary sequence of the following strand? CCCCTTAGGAACC? a. CCCCTTAGGAACC b.…

A: Nucleic acids are biopolymers formed of repeating units of monomers called nucleotides. There are…

Q: 7. What is the base sequence, specified in the 5' to 3' direction, for a segment of newly formed DNA…

A: The genetic material in most organism is double stranded DNA with the two strands running in…

Q: .1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and…

A: The Chargaff’s rule state that the quality of the nitrogenous base pairs in the DNA is always equal.…

Q: 5'- What will be the Sanger products of the DNA with base sequence ACGTCGACTCCGGTC-3'

A: DNA sequencing is the biochemical method used for determining the order of nucleotide bases, A, G,…

Q: 28. Structure of DNA is shown. What are the bonds between 2 nitrogenous bases? A::: P TC A T G A a.…

A: The given diagram represents Watson and Crick model of double helical structure of DNA . DNA helix…

Q: 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA…

Q: Give at least two differences between prokaryotic and eukaryotic DNAs

A: Prokaryotic cells do not possess membrane bound organelles and nucleus whereas, eukaryotic cell…

Q: 1. Explain why the primary structure sequence -Lys-Leu-Trp-Asp- may promote a-helix formation while…

A: The formation of α helix is occurred due to attachment of H of N of Cα of first (n) amino acid to…

Q: 6. Write a brief paragraph each to explain what an insertion sequence and a transposon are. 7. What…

A: 1. Inclusion arrangements (Insertion sequences) (ISs) are little bits of DNA which move inside or…

Q: 7. How many hydrogen bonds exist between this DNA strand and its complementary strand?…

A: The DNA strand is a double helical strand which consists of two strands that run in an anti-parallel…

Q: 2. Provide the sequences of the template and coding strands of a DNA double helix that was used to…

A: The RNA or ribonucleic acid is produced from the DNA by the transcription process. RNA is used for…

Q: A+ AT D THA E 1. Identify a nucleotide of DNA. 2. Identify the labelled deoxyribose sugar. 3.…

A: Hi, Thanks For Your Question. Answer : 5 And 6 Are Answered Here, Rest Labelled in Diagram.…

Q: If one DNA single strand has the sequence 5’-AATGCAA-3’, what is the sequence of its complementary…

A: "Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: 9.)Which of the following does NOT describe the molecular structure of (DNA) Deoxyribonucleic Acid?…

A: 9- DNA is a double helix ,deoxyribose sugar made up of nitrogenous bases while RNA is ribose sugar.…

Q: 8 How natural processes can change the information stored in DNA?

A: Genetic information is stored in the chemical structure of DNA molecule. DNA molecule contains two…

Q: 8. Shown below is a DNA strand. 5' GACGTACTACGACTATGGC 3' What is the correct representation of its…

A: Introduction: DNA is a type of nucleic acid present in the nucleus of the cell. It is a genetic…

Q: 25. Which sequence includes RNA that's complementary to the DNA sequence 5'-TATTCGC-3'? (Hint: in…

A: Adenine(A) and guanine(G) are purines ; cytosine(C) and thymine(T)/uracil(U) are pyrimidines , both…

Q: 7. Which of the following best characterizes the events that occur at an origin of DNA replication?…

A: Replication is the process of duplication of individual strands of a double stranded DNA. The…

Q: In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where…

A: These grooves arise in DNA molecules because the glycosidic bonds of a base pair are not…

Q: 8. For each of the following DNA template strands a. 3' TACGGC 5' b. 3' CCATTA 5' Determine: a. the…

A: The heterogenous nuclear ribonucleoprotein (hnRNP) is the initial step of synthesizing mRNA during…

Q: 19. You have reasonably short, typical, double stranded DNA sequence. Basically how many proteins…

A: DNA's molecular structure is referred described as a "double helix." Two connected strands that…

Q: 0. The two strands of DNA that make up the double helix are held to each other by … a)…

A: The correct option is A hydrogen bonds between guanine / cytosine, and thymine / adenine

Q: 30 A DNA sequence encoding a five-amino acid polypeptide is given below.…

A: Codons are the mRNA triplet nucleotides and are the coding sequences. They are translated to form a…

Q: 7. An original strand of DNA has the following sequence of nucleotides: NNNNONNNNNNINN CC AT CTGGA…

A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polymeric molecules essential in various…

Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer.…

A: DNA It is a nucleic acid that constitutes two polynucleotide chains that are complementary in…

Q: 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: 9- Considering the structure of double-stranded DNA, which kind(s) of bonds hold one complementary…

A: Deoxyribose Nucleic acid (DNA) is the basic genetic material of life. It is made up of two strands…

A: Purines is equal to pyrimidines. So A=T C=G

Q: 3. Give the different hydrolytic products of : a. DNA b. RNA

A: DNA and RNA are made up of long chains of nucleotides. Sugar molecule, ribose in RNA, and…

Q: 1. What is the first codon in the mRNA strand? 2. The second codon in the DNA double helix is TAT…

A: The DNA (deoxyribonucleic acid) that forms the genetic material of an individual contains…

Q: if one strand of the DNA molecule has the sequence 5’ TACGA 3, The other strand would have the…

A: DNA or Deoxyribonucleic acid is the genetic material which passes from one generation to another.…

Q: 4) Replication of a circular DNA molecule can occur by either theta replication or by rolling circle…

A: Circular DNA - Circular DNA is a kind of DNA that is in the form of loop. Circular DNA has no free…

Q: 6. H₂C HO Which of the following dinucleotides can be methylated by DNA methyltransferase? NH₂ NH₂ 9…

A: Since you have asked multiple questions, we will answer only first question for you. In order to get…

Q: 6. If you are given the DNA sequence: T-A-C-C-G-A-A-T determine the complementary RNA strand.

A: Introduction :- The term "DNA sequencing" refers to a common laboratory procedure for determining…

Q: List the DNA strand sequence complementary to the template strand.…

A: DNA contains Adenine thymine, cytosine, and Guanine. Whereas in RNA the Thymine is replaced by…

Q: 40) What external factor (aka, damaging agent) gives rise to the following DNA mutations? Write and…

A: Multiple questions with three parts are asked. I will answer for the question A , as per guidelines.…

Q: 14. For the diagram at right, please label the following words on the diagram. (A) Deoxyribose…

A: Note - Since you have asked multiple questions, we solving the first three for you. Please post the…

Q: (1) Describe the nitrogenous base pairing in DNA and RNA. (2) Determine the number of bonds in each…

A: DNA and RNA are polynucleotides. Monomers of nucleic acids are nucleotides. Nucleotides are made up…

Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT…

A: Note - Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a…

A: Answer is option 1 Explained in paper pen format in step 2

Q: 1) The function of ligase is to seal nicks in the backbone of a DNA strand. The function of AP…

A: AP endonuclease : It is an enzyme which is involved in the DNA base excision pathway The main…

Q: 5. Create the complimentary strand for the DNA strand below. Make sure to label the parts and…

A: The base pairing rule of DNA is purine always pairs up with pyrimidine. Adenine(A) and Guanine(G)…

Q: Regarding the triple DNA code, which of the following statements is true?

A: The genetic code refers to the set of rules that all living organisms use to encode information,…

Question

34.

Give the sequence of the complementary DNA strand of the DNA chain with the following base sequence:

5’-TATGGCATAC-3’

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

DNA double helix does not have which of the following? antiparallel configuration complementary base pairing major and minor grooves uracil
Each DNA strand has a backbone that consists of alternating (a) purines and pyrimidines (b) nucleotide bases (c) hydrogen bonds and phosphodiester linkages (d) deoxyribose and phosphate (e) phosphate and phosphodiester linkages
The two complementary strands of the DNA double helix are held to each other by (a) ionic bonds between deoxyribose molecules (b) ionic bonds between phosphate groups (c) covalent bonds between nucleotide bases (d) covalent bonds between deoxyribose molecules (e) hydrogen bonds between nucleotide bases
Topoisomerases (a) synthesize DNA (b) synthesize RNA primers (c) join Okazaki fragments (d) break and rejoin DNA to reduce torsional strain (e) prevent single DNA strands from joining to form a double helix
Describe how the two strands of DNA are oriented with respect to each other.
Describe the structure and complementary base pairing of DNA.
The experiments in which Meselson and Stahl grew bacteria in heavy nitrogen conclusively demonstrated that DNA (a) is a double helix (b) replicates semiconservatively (c) consists of repeating nucleotide subunits (d) has complementary base pairing (e) is always synthesized in the 5 3 direction
The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is copied (b) first one DNA strand is copied and then the other strand is copied (c) the two strands of a double helix have identical base sequences (d) some portions of a single DNA strand are old and other portions are newly synthesized (e) each double helix consists of one old and one newly synthesized strand
Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG ATCCGCGC CGAATATA TGCCTCTC
Which of the following is/are not required for DNA replication to occur? a. DNA polymerase b. nucleotides c. template DNA d. primers e. helicase f. all are required
Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from_______. a. ATP b. DNA polymerase c. the nucleotide d. a and c
How does the double helix structure of DNA support its role in encoding the genome? The sugar-phosphate backbone provides a template for DNA replication tRNA pairing with the template strand creates proteins encoded by the genome Complementary base pairing creates a very stable structure Complementary base pairing allows for easy editing of both strands of DNA.