Given the sequences of a particular gene in fruit flies, fish, mice, andhumans, predict the relative similarity of the human sequence to thatof each of the other species
Q: Explain why the genetic code is said to be redundant and virtually universal? How these features may…
A: Amino acids are building blocks of proteins. They are a set of rules that governs how codons are…
Q: It has been suggested that the present-day triplet genetic codeevolved from a doublet code when…
A: The genetic code is characterized as the structure of nitrogen bases and mRNA particle which…
Q: AKS 5a: Use the table below to answer the question that follows. Trout are a fish that are closely…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: COYOTE: Use your translated amino acid sequences to determine the phenotypes to include in your…
A: Phenotype are the external characteristics of any individual.
Q: Mobile genetic elements, such as the Alu sequences, are found in many copies in human DNA. In what…
A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…
Q: A molecular geneticist hopes to find a Gene in human liver cell that codes for an important…
A: In heredity, gene occupies the basic physical and functional unit. They are found to be composed of…
Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: With the help of the Human Genome Project, it has now become possible to sequence all of the genes…
Q: Genome size varies considerably among multicellular organisms. Is this variation closely related to…
A: Genes contain sequences of nucleotides which are present on chromosomes. Genome complexity consists…
Q: Other than obvious changes in protein-encoding Neanderthal genes, changes in what type of non-coding…
A: Small tandem repeats (STRs) are short repeating DNA sequences (2–6 bp) that contribute for about 3%…
Q: In instances in the eukaryotic genome, DNA sequences repre- sent evolutionary vestiges of duplicated…
A: The genes can be acquired by a genome through several distinct methods. One method is through the…
Q: The genes for ribosomal RNA are highly conserved(relatively few sequence changes) in all organisms…
A: Genes are the hereditary unit of an organism. The DNA (deoxyribonucleic acid) forms the genes. DNA…
Q: I need a key for my practice exam thank you
A: 1.Answer-
Q: Highly conserved genes such as those for ribosomal RNA are present as clearly recognizable relatives…
A: The genetic material is the heritable information that is passed on from one cell to the progeny…
Q: The A+T:G+C ratios in DNA of cattle and rat are very similar. Would you expect the +RNAs, rRNAs,…
A: Gene expression refers to the highly regulated complex biological mechanism involving the…
Q: A 2500 bp region of the human genome encodes two genes. One of the genes encodes a protein of 600…
A: Adenine, Guanine, Thymine and Cytosine are the base pairs which are present in DNA and in RNA Uracil…
Q: The total number of possible amino acid sequences in a polypeptide chain is staggering. Given that…
A: Only a small fraction of the vast set of the conceivable polypeptide chain would be able to adopt…
Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: A desired gene is defined as the insertion of copies of the gene into the living cells in order to…
Q: What evidence supports the concept that humans share substantial sequence similarities and gene…
A: Comparison of base sequence data with other organisms indicates conservation of sequences.
Q: Why mammals genomes are way longer than simple organisms, such as birds and insects, even though the…
A: Mammal’s genomes are longer than simple organisms, such as bird and insects even number of genes is…
Q: Exon duplication of multiple alpha-helix coding domains is thought to be responsible for the origin…
A: Vertebrates have spinal cord which remain surrounded by bone or cartilage. Mammals are vertebrate…
Q: People who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA…
A: A genetic disorder is an inherited abnormal condition concerning the genetic material i.e. DNA.…
Q: You discover that zebrafish contain a gene that has a similar sequence to Drosophila abdoless.…
A: Drosophila melanogaster also known as fruit fly studied extensively in biology due to similar…
Q: A geneticist discovers that two different proteins are encoded by the same gene. One protein has 56…
A: A gene is a stretch of nucleotides present in the DNA molecule. It encodes information for the…
Q: The words “transcribe” and “translate” are more commonly associated with language and dialogue. For…
A: Molecular biology is the biology that deals with structure and function of macro molecules such as…
Q: If the amino acid sequences of monkeys and humans in the protein of two organisms are similar, why…
A: Amino acids Amino Acids are known as building blocks of proteins. There are many different kind of…
Q: When the human genome sequence was finally completed, scientists were surprised to discover that the…
A: Genetics is the branch of biology which deals with genes, heredity, and genome in the organism.…
Q: The prevalence of highly repetitive sequences seems rather strangeto many geneticists. Do they seem…
A: A tandem repeat is a sequence of two or more DNA base pairs that are repeated in such a manner that…
Q: Why do humans have such a large number of nucleotides (3.2 billion base pairs) compared to the…
A: The genome is the sum total of all genetic material of an organism which stores biological…
Q: Comparing DNA sequences in different species indicates that more DNA segments that do not code for…
A: DNA contains lot of nucleotides and most of the DNA which do not codes for any functional product…
Q: The A+T: G+C ratios in the DNA of cattle and rats are very similar. Would you expect the tRNAs,…
A: Ribonucleic acid (RNA) is a vital biological macromolecule found in all living organisms. It is…
Q: many more mRNA transcripts than there are genes. Why isn’t the number the same?
A: Regulatory protein (or gene-regulatory protein) is any protein that controls the transcription.…
Q: Sequences of an RNA fragment from five species have been determined and aligned. Propose a likely…
A: Ans: Secondary structure of RNA: The RNA shows stem as the form of secondary structure, it is formed…
Q: 2b)An ancient gene underwent duplication during the course of evolution to yield two chain genes…
A: A phylogenetic tree is a branching diagram or tree that depicts the evolutionary relationships among…
Q: wo genes that evolved from the same common ancestral gene, but are now found as homologs in…
A: Gene is the functional and basic unit of heredity, made up of DNA. Every organism is composed of…
Q: A fairly conserved gene is compared between a human, a chimpanzee, a bear and a banana. How would…
A: A fairly conserved gene is compared between a human, a chimpanzee, a bear and a banana.
Q: The A+T: G+C ratios in the DNA of cattle and rats are very similar. Would you expect the tRNAs,…
A: Chargaff's rules note that purine and pyrimidine bases in DNA from any type of organism should have…
Q: central dogma of molecular biology describe the flow of information in the cell.There are also…
A: Central dogma is invented by fransic Crick in 1958. Which explains the flow of genetic information.…
Q: Exon duplication of multiple repeating subunits is thought to be responsible for the origin of which…
A: Vertebrates have a spinal cord that remains surrounded by bone or cartilage. Mammals are vertebrate…
Q: You are interested in finding out the function of a particular gene in the mouse genome. You have…
A: There are multiple ways to have a distinct character for the gene expression and function. And the…
Q: When RNA alignments are used to determine secondary structure, it is advantageous to have many…
A: The RNA structure, the secondary structure, the alignment helps to predict the similarity, which…
Q: Duchenne muscular dystrophy is caused by a mutation in a gene that comprises 2.5 million base pairs…
A: Dystrophin gene the largest known human gene provides instructions for making a protein called…
Q: A molecule geneticist hopes to find a gene in human liver cells that codes for an important…
A: As Only a partial sequence of the desired gene that codes for the blood clotting protein in liver is…
Q: Describe experimental evidence that would indicate that most or nearly all of the DNA sequences in a…
A: DNA is the chemical name for the molecule that carries genetic instructions in all living things.
Q: The human genome does not encode substantially more protein domains than do invertebrate genomes,…
A: The genome of an organism is defined as the whole heredity information encoded in the genetic…
Q: Explain why the genetic code is said to be redundant and virtually universal, and discuss how these…
A: The flow of genetic information from DNA to proteins occurs via mRNA.
Q: Explain why many traits encoded by mtDNA and cpDNA exhibit considerable variation in their…
A: The genetic material of a cell is found in both the nucleus and the cytoplasm. The characteristic…
Q: Examine the following sashimi plot from a transcriptomics experiment. The red peaks mostly RNA STAR…
A: Despite of immense growth in science and technology of sequencing of RNA and DNA, it was challenging…
Q: What evidence supports the concept that humans share substantial sequence similarities and gene…
A: Model organisms are non human species that are used in the laboratory to help scientists understand…
Given the sequences of a particular gene in fruit flies, fish, mice, and
humans, predict the relative similarity of the human sequence to that
of each of the other species
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A fairly conserved gene is compared between a human, a chimpanzee, a bear and a banana. How would you expect their DNA sequences to relate?a molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answerThe following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do not begin and end at the same location. Try to line them up according to their homologous regions.
- In instances in the eukaryotic genome, DNA sequences repre- sent evolutionary vestiges of duplicated copies of genes. What are such regions called and what are their characteristics?Explain the statement "In a comparison between the DNAS of related organisms such as humans and mice, identifying the conserved DNA sequences facilitates the search for functionally important regions" is true or false.In genomes the potential duplicate/paralog share the same annotation but have lower sequence similiarity. Discuss what could have caused this difference and its possible driver.
- Mobile genetic elements, such as the Alu sequences, are found in many copies in human DNA. In what ways could the presence of an Alu sequence affect a nearby gene?A molecular geneticist hopes to find a gene gene in human liver cells that codes for an important blood clotting protein. He knows that the nucleotides sequence of a small part of the gene is GTGGACTGACA. briefly explain how to obtain the desired geneA molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain gene
- Why mammals genomes are way longer than simple organisms, such as birds and insects, even though the number of genes is not that different?Consider three different kinds of human libraries: agenomic library, a brain cDNA library, and a livercDNA library.a. Suppose that all three of these libraries are sufficiently large so as to represent all of the differenthuman nucleotide sequences that the library couldpossibly include. Which of these libraries wouldthen correspond to the largest fraction of the totalhuman genome?b. Would you expect any of these libraries not tooverlap the others at all in terms of the sequences itcontains? Explain.c. How do these three libraries differ in terms of thestarting material for constructing the clones in thelibrary?d. Why would you need to sequence many clonesfrom many cDNA libraries to annotate a genome?A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting. He knows that the nucleotide sequence of a small part of the gene is GTGGACTGACA. Briefly explain how to obtain the desired gene.