AnswerQuestion 2 of 3>Histones are proteins found in eukaryotic cell nuclei, tightly bound to DNA, which has many phosphate groups. The isoelectricpoint (pI) of histones is very high, about 10.8.What types of amino acid residues must be present in relatively large numbers in histones?O small amino acids such as glycine and alanineO negatively charged amino acids such as aspartic acid and glutamic acidO positively charged amino acids such as arginine, histidine, and lysineO uncharged amino acids such as valine, alanine, and isoleucineShow All2 Final Draft of Fi.docxMacBook AirDIIDDF1280888F8F9F7F5F6F4F323$de7834PRYU%3DJKD.くCVNoption. ..「レ-エト

A protein is a naturally occurring, polymer of amino acid residues linked by peptide bonds. Proteins…

Answered: Histones are proteins found in…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Good afternoon, Guidance with this question would be most appriciated. Thank you for your time. Polypeptide sequences are formed from 20 amino acids. What is the probability that a single point mutation in a gene will result in a different polypeptide sequence?
Histones are proteins found in eukaryotic cell nuclei, tightly bound to DNA, which has many phosphate groups. The pI of histones is very high,about 10.8. What amino acid residues must be present in relatively large numbers in histones? In what way do these residues contribute to the strong binding of histones to DNA?
Give typing answer with explanation and conclusion 5'ATTAGGAGGTGCGTTATGCAGGCATGTTACGTACGTACG,TAAGATAAGTACT3’ 3' TAATCCTCCACGCAATACGTCCGTACAATGCATGCATGCATTCTATTCATGA5’ In the above piece of double stranded DNA, how many potential translations start sites exist if an mRNA could be synthesized from any portion of this DNA? Indicate where they are in the DNA above and explain how you found this number.
True or False 1. Histone proteins are able to associate with DNA segments because of the anionic nature of the amino acids arg and lys. 2. DNA molecules can perform their function in replication and transcription as long as the hydrogen bonds between the bases remain intact. 3. A double helix makes one complete turn every 10 residues (3.4nm). Therefore the distance between base pairs is 0.34nm.
please answer everything thank you 3. What intermolecular bond has the greatest influence on the coiling of DNA to the histone complex?A. Electrostatic interactionB. Covalent bondC. Van der Waals interactionD. Phosphodiester bond 7. What is the sequence following compounds in terms of increasing solubility to dilute methanol solution?A. Adenine → Adenosine → Adenosine monophosphateB. Adenosine monophosphate → Adenosine → AdenineC. Adenine →Adenosine monophosphate → AdenosineD. Adenosine diphosphate → adenine → Adenosine triphosphate
CAN YOU PLEASE ANSWER 1b 1a) The phosphate groups in the sugar-phosphate backbone of each strand of a DNA molecule have a pKa of ~2.14. Normal physiological pH in most cells is 7.0-7.5, which is significantly above the pKa for the phosphate groups, so every phosphate group in the backbone of both strands of a DNA molecule is deprotonated and carries a -1 charge - but DNA in cells is normally double-stranded. Briefly explain, in your own words, why the large negative charges on the backbones of the two strands of a double-stranded DNA molecule don't cause the strands to separate under normal cellular conditions. 1b) If you raise the pH to 12, but keep everything else about the solution in which the double-stranded DNA is dissolved the same, the two strands of DNA will separate/the DNA will denature. Briefly explain, in your own words, why this happens - why does DNA denature at pH 12 but not at pH 7?
Please answer fast Determine the amino acid sequences for the six open reading frames for this 9 nucleotide sequence: 5'-AAATTTGGG-3'
All questions a) What is the DNA base sequence of Codon 1? b) What is the anticodon sequence for Codon 1? c) Name the enzyme involved in the production of Y.
Question: Hi, can someone help me with this question thanks in advance. Select one of the following genetic diseases that appear in the following list:galactosemiacystic fibrosisDown's Syndromefamilial hypercholesterolemiamuscle gystrophyHuntington's diseasesickle cell anemiahemophiliaTay-Sachs diseasedescribe a composition about how the selected condition is generated. Include details about the number of people who report the disease, symptoms, treatments, among other aspects that you consider important. thanks
Please answer all questions GTTTTCACTGGCGAGCGTCATCTTCCTACT 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; Journal Name; Volume; Page Numbers) for a recent publication involving the identified gene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebrate homolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the identified putative protein products with at least one similar invertebrate protein (if there is none, use a vertebrate homolog).10. Generate a secondary structure prediction for one identified protein.
Please answer only questions 5-10, thank you GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; Journal Name; Volume; Page Numbers) for a recent publication involving the identified gene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebrate homolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL…
Please answer asap and in short and content should not be palgarised please 1. what reaction activates the amino acids for attachment to the appropriate tRNA before being delivered to the ribosomes?

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS