What amino acids do the following sequences code for?(a) AUC (b) GCU (c) CGA (d) AAG

Q: If a protein is created via the translation of 705 nucleotides, including a start and a stop codon,…

A: The translation is a process in which an mRNA is read and then a polypeptide, made up of different…

Q: What is the Three-Dimensional Structure of a Protein’s Amino Acid Sequence Dictates?

A: The amino acids join together by peptide bonds. Proteins act as major substrates and reactants for…

Q: Which proteins help other polypeptides to fold into the right shape?

A: Proteins are composed of amino acids. They are linked together by peptide linkages. Proteins have…

Q: What two processes ensure that the correct amino acidis added to a growing polypeptide chain?

A: The tRNA is a transfer RNA. It reads the nucleotide present on the mRNA and translates that mRNA…

Q: How is the peptide shown named (give each 3-letter name for the amino acids present)? Whichamino…

A: The peptide is made up of amino acid. The sequence of amino acid in this peptide is N - Val-Phe-Trp-…

Q: What is the name of an RNA sequence that codifies one amino acid?

A: RNA or Ribonucleic acid is a polynucleotide containing ribose sugar, phosphate and nucleotide bases…

Q: What do the complementary shapes of the ligand and the protein-binding site determine?

A: Ligands are molecules with which proteins interact via various bonds and forces. It can be an…

Q: Why are multifunctional proteins necessary and/ordesirable?

A: Proteins are composed of a long chain of amino acid, which is bonded by the peptide bond. This…

Q: Since among the 64 codons of mRNA 61 codify amino acids that form polypeptide chains what are the…

A: The function of the other codons is stop codon i-e to stop the translation.

Q: Name the enzyme responsible for binding of aminoacid to trna?

A: Ribonucleic acid (RNA) is a biomolecule that plays important role in coding, decoding, and…

Q: How many peptide bonds are present in peptide 1? What is the N-terminal amino acid in peptide 2?…

A: Peptides are made up of amino acid joined together by peptide bond. Peptide bond is formed between…

Q: How many human proteins are in the range of 250,000 to 900,000 Daltons?

A: The human body is thought to have over a million different types of protein, and even a single-cell…

Q: Which amino acid sequence is likely to be found on the exterior of a soluble protein?

A: Proteins are polymers of amino acids linked by amide/peptide bonds. Amino acids are consist of amine…

Q: using,   3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: Define the process of Drawing the Structure of a Peptide from Three-Letter Symbols ?

A: The polypeptide chain is a polymer, which is formed from the incorporation of amino acids. These…

Q: What Role Does the Amino Acid Sequence Playin Protein Structure?

A: Proteins are biomolecules constituted by amino acids long chains linked by a peptide bond which…

Q: What is a mutation, and how might it result in a change in the primary structure of a protein?

A: Mutation is change is base pair of nucleotide sequence.it may occur spontaneously or induced.most…

Q: what are the secondary and tertiary sturcture of proteins?

A: There are different structural levels in proteins. Proteins have four structural levels called…

Q: Assume that the number of different types of bases in RNA is four. What would be the minimum codon…

A: The formula is 4^n as number of nucleotide is 4. n is the number of nucleotide in codon. It will be…

Q: what are the four interactions that keep the protein structure intact?

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Which of the following best describes an amino acid that can be used to synthesize proteins?

A: Monoprotic acids - are the acids that donates only one proton (H atom) per molecule of acid to an…

Q: what is the sequence of peptide 4?

A: DNA sequencing is a biochemical method for determining the order of the nucleotide bases, adenine,…

Q: What do you name the binding between two amino acids?

A: An organic molecule comprised of a carboxyl and an amino group is known as amino acids. When amino…

Q: Which protein structure is due to interactions between amino acid side-chains? tertiary, quaternary,…

A: The structure of proteins have four levels of structure called the primary, secondary, tertiary and…

Q: what is the sequence of peptide 1?

A: A nonpeptide is the a polypeptide containing nine amino acids linked via peptide bonds. The sequence…

Q: Which two amino acids do you think are the least soluble in water?

A: 1-The solubility of amino acid in water and their insoluble nature in non-polar organic solvents…

Q: How does the amino acid sequence of a protein specify its threedimensional structure?

A: Protein structure is the three dimensional arrangement of atoms in an amino acid chain. Proteins are…

Q: How are tRNAs linked to their corresponding amino acids?

A: tRNA stands for transfer RNA. It has a clover leaf like structure.

Q: What are charging of Trna?

A: tRNA stands for transfer RNA. It has a clover leaf-like structures.

Q: How many different proteins, each with a unique amino acid sequence, can be constructed that have a…

A: Proteins are made up of amino acids. Proteins are necessary for carrying out daily functions. There…

Q: Why is knowing the protein sequence important?

A: All proteins in all three classes of organisms i.e bacterial, archaeal, and eukaryotic—are…

Q: What would the peptide sequence be like after translation?

A: Translation is the process by which polypeptide or protein is produced from the mRNA by the help of…

Q: How does a polypeptide fold to become a functioning protein?

A: Polypeptides are formed by amino acids. These amino acids are held with each other by peptide bonds.…

Q: Why is it no longer considered necessary to determine theN-terminal amino acid of a protein as a…

A: Proteins are the building blocks of the body. It plays an essential role in the body. Many enzymes…

Q: what us bZIP and bHLH protein domains? how are they similar? how are they different?

A: Enzymes can bind to DNA to regulate different processes of DNA by certain motifs .

Q: What are relatively small proteins with a preponderance of the basic, positively charged amino acids…

A: Amino acid such as lysine, arginine, and histidine has basic positively charged groups in their side…

Q: What amino acid sequence is coded for by the mRNA base sequenceCUC-AUU-CCA-UGC-GAC-GUA?

A: The sequence of a protein is notated as a string of letters, according to the order of the amino…

Q: What kind of bond is created between successive amino acids in a protein? If there are more codon…

A: Proteins are made up of chemical 'building blocks' called amino acids. Nucleotide is the basic…

Q: What are the difference between chitosan and TiO2?

A: Difference between chitosan and Ti02 1.Chitosan is the natural linear polysaccharide derived from…

Q: Suggest which part of this sequence belongs to the inner part of the protein and which to the outer…

A: Proteins are polypeptides formed of monomeric units-amino acids. There are 20 different amino acids…

Q: What is the effect of the altered amino acid sequence in Hb S that causes the cells to form sickle…

A: Introduction: Sickle cell anemia is an inherited disorder in which the shape of red blood cells…

Q: What is a protein domain?

A: Proteins are large , complex molecules in the body that play a lot of critical roles.Proteins…

Q: How many codons are needed to specify one amino acid?

A: We know Codon are triplet of nucleotide.

Q: 1. What is the N-terminal AA residue? 2. What is the C-terminal AA residue? 3. What is the sequence…

A: Since you have asked a question with multiple subparts, we will answer only first three subparts for…

Q: How is the sequence of amino acids specified?

A: Proteins or peptides are made up of 20 different amino acids which are arranged to form a myriad…

Q: What is the name of the process by which amino acids arelinked together in the correct order based…

A: Translation is a process that has “decoding” a messenger RNA (mRNA) that is used to build a…

Q: What are the "N" and "C" termini of proteins?

A: The structure of a peptide is given below. By convention, on the left there is N-terminal and the on…

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). 

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.