How to find mrna for CAT AGG GAS

Q: Derive the amino acid sequence that is coded for by the following mRNA sequence. 5' CAU AAA ACG GUG…

A: During the translation, the information present in the mRNA sequence results in the formation of…

Q: What is a common activating EGFR mutation in lung cancer? O deletion of codon 858 in exon 21 O…

A: EGFR stands for Epidermal growth factor receptor.These receptors are basically the family of…

Q: In this MRNA sequence, what reading frame is the START CODON (AUG) in? ACGGAUGCACGUACGU Select one:…

A: Reading frames are the division of DNA or RNA sequences in a set of non-overlapping sets of…

Q: The RNA complement of a protein coding gene is what? A) mRNA B) rRNA C) snRNA D) tRNA

A: Explanation: The mRNA specifies, in triplet code, the amino acid sequence of proteins

Q: Design an experiment to determine whether a specific gene is transcribed by RNA polymerase II.

A: RNA polymerase II (Pol II) is responsible for the flow of genetic information from DNA to messenger…

Q: If the DNA gene reads AAT GGT CCA CCG CTG, what will the MRNA read? O A. TTA CCA GGT GGC GAC O B.…

A: DNA is a macromolecule and is composed of nucleotides having sugar , phosphate and nitrogenous bases…

Q: What is the name of the enzyme that adds new nucleotides to build mRNA?

A: Transcription It is defined as the process through which the information in a DNA strand is copied…

Q: Two examples utilize RNA reverse transcription in their biology, what are they?

A: Reverse transcription is the exact opposite of the transcription. It involves the synthesis of the…

Q: TRANSCRIBE THE GENE INTO mRNA:   TACCAGTTAGTCGTAGA

A: Transcription is process of copying a DNA segment into RNA.

Q: DNA Sequence:     TAC  TCC  GGC  TCT  CCC  AGT  TGA  ACT Mutated Sequence: TAC  TCT  GGC TCT  CCA…

A: Any modification of a cell's DNA sequence. Mutations can occur as a result of errors made during…

Q: If the DNA duplex for the beta chain of haemoglobin 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5' were…

A: Answer: TRANSCRIPTION = It is process of transcribing a strand of DNA using RNA polymerase which…

Q: What is the amino acid sequence coded by this mRNA? MET SER ARG ASP VAL THR VAL LEU VAL SER O GLN…

A: A codon table can be used to convert a genetic code into an amino acid sequence. Because messenger…

Q: Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an…

A: Transcription factors are the class of nuclear proteins that facilitate transcription. It is studied…

Q: B. Does evervone have a copy of this gene? Explain vour answer.

A: Only b part of the question has been asked which is explained in the following step. APP: It is the…

Q: What is the first step in the production of a siRNA? O infection with a virus O transcription from a…

A: Si RNA means small inhibitory RNA .

Q: Met – Asn – Cys – Phe – Glu – Met – Leu – Arg – Ile – Asp – Glu – Gly – Leu – Arg – Leu – Lys – Ile…

A: The central dogma of molecular biology states that it is the unique nucleotide sequence in DNA which…

Q: Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3 This is an mRNA…

A: mRNA stands for messenger RNA and it corresponds to the genetic sequence of a gene which is read by…

Q: Write a possible sequence for an mRNA segment coding for apamine

A: Introduction  Genome is referred to the total amount of DNA a single haploid cell contains. Genome…

Q: What's the mRNA sequence for TACATCTTGGCGACGACT

A: mRNA is a single-stranded RNA that developed during the transcription in a cell. This is also known…

Q: 1. DNA Sequence: TẠC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA GTT GAA CT…

A: As per our guidelines, we are supposed to answer only one question. Please repost other question in…

Q: The eukaryotic metallothionein gene promoter consists of all EXCEPT: (A) MRE (в) GC Box c) GRE D…

A: Introduction Metallothionein is a protein that has a high affinity toward binding heavy metal ions,…

Q: What is the structure and function of transfer RNA

A: Ribonucleic acid (RNA) is a nucleic acid that has structural similarities to DNA and is found in all…

Q: A binding site for RNA polymerase is called a .a. gene c. codonb. promoter d. protein

A: Transcription is a process in which one strand of DNA known as template strand is known as converted…

Q: The FOXP2 gene is sometimes called the “language gene.” Why is this name inaccurate?

A: The FOXP2 gene present in many vertebrate including human beings. It encodes a protein Forkhead…

Q: In bacteria, single polycistronic MRNA encodes for:

A: This question is based on polycistron.

Q: Provide the abbreviation for the amino acid sequence expected from the following MRNA segment using…

A: Following amino acid sequence is predicted.

Q: From TAC CTA CTC TAG TTA ACC ACA GTT GCC ATC. Translate the mRNA sequence.

A: The givem template sequence is as follows,  TAC CTA CTC TAG TTA ACC ACA GTT GCC ATC Template strand…

Q: A.Give the transcript that will be formed from this template. 3- TACGGGTTATATTCAATC-5" B.Give the…

A: The DNA is copied into RNA (transcript) by a process called transcription. It takes place inside the…

Q: Given the sequence of the DNA template GTCATG. What would be the mRNA.

A: mRNA sequence for GTCATG will be CAGUAC .

Q: The following diagram depicts the elements at the: Ba cgcc tataan 999 AC ATT BRE TATA box Inr DPE…

A: The diagram depicts  elements at the Promoter  :

Q: What are the nucleotides of the mRNA from gene Z? (see the attached picture)

A: Transcription is the process of synthesis of mRNA from DNA. The DNA strand which acts as the…

Q: 42/ 50 The port mutation that doesn't produce a change in the amne act sequence of proten is known…

A: Introduction: A mutation is a change in our DNA sequence that happens as a result of errors in DNA…

Q: Which eukaryotic RNA polymerase (RNA pol I,pol II, or pol III) transcribes which genes?a. tRNAsb.…

A: RNA polymerase is an enzyme that synthesizes RNA from a DNA template. Different RNA polymerases…

Q: Name and describe three ways in which gene expressioncan be influenced after mRNA is processed and…

A: A gene is a stretch of nucleotides present in the DNA molecule. It encodes information for the…

Q: discuss how pre mRNA is formed in the nucleus and the RNA processing that happen to form a matured…

A: When an RNA transcript is first made in a eukaryotic cellular, it's far taken into consideration a…

Q: A gene with the following DNA sequence is transcribed and translated: 5’ TAGCTACGGAAAGCGTACACGGACT…

A: Transcription is the process of the formation of RNA from the DNA template strand.

Q: How many amino acids are coded for by the following mRNA: 5…

A: From the DNA, genetic information is transcribed in the form of codons. These codons reside in the…

Q: Which pre-mRNA processing step is important for initiating translation? a. poly-A tail b. RNA…

A: RNA processing comes after the transcription (DNA to mRNA), where the synthesized mRNA is only being…

Q: tRNAs a. carry amino acids b. bind to the anticodon present in the mRNA c. adapt the genetic…

A: Introduction Transfer RNA (tRNA) is a short RNA molecule that aids in the production of proteins. A…

Q: Describe how the genome of bacteriophage fX174 istranscribed and translated.

A: Bacteriophages are special type of virus that can infect a bacterial species.

Q: The following diagram depicts the elements at the: Ac TTC g99 Eca cgcc tataan ATT BRE TATA box Inr…

A: The core promoters are contiguous DNA sequences sufficient to initiate the accurate initiation of…

Q: how does the E.coli RNA polymerase find the gene's promoter to be transcribed? A. the TATA…

A: The transcription of DNA into RNA is catalyzed by DNA dependent RNA polymerase enzyme. There are…

Q: What types of RNA are found in yeast cells?

A: Saccharomyces cerevisiae or yeast is a single-celled organism that requires food, temperature, and…

Q: Eukaryotic mRNA is capped at the 5' end by:

A: Eukaryotic messenger RNA after synthesis in the nucleus move to the cytoplasm for translating…

Q: define Bar gene

A: Gene is the hereditary unit of an organism which can be inherited from parent to the offspring. This…

Q: The DNA sequence of a gene is CCATGCT A. The corresponding mRNA produced from 6. this gene is a.…

A: The protein synthesis consumes large amount of a cell’s energy as compared to the other organic…

Q: GAC UAU GCG GGA GGO AAG CA UGA iwhat is The auino a cid that would Lesult from this m RNA SeepuenU?

A: Adenine in RNA binds with uracil (Thymine is replaced by uracil in RNA) and guanine with cytosine.…

Q: Gene B has a mutation in its promoter sequences changing TATA to GAGA. What will this mean for…

A: Transcription is a process under central dogma, where RNA polymerase can bind with template strand (…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.