Answered: Provide the abbreviation for the amino…

Provide the abbreviation for the amino acid sequence expected from the following MRNA segment using the hree-letter amino acid codes: 5' UUUICCCIAAUIAUUIACG 3'

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Related questions

Q: Derive the amino acid sequence that is coded for by the following mRNA sequence. 5' CAU AAA ACG GUG…

A: During the translation, the information present in the mRNA sequence results in the formation of…

Q: The maximum number of amino acids that coded by 40 nucleotides in the MRNA are

A: mRNA plays a specific role in protein synthesis in the cell.

Q: Derive the amino acid sequence that is coded for by each of the following mRNA sequence. 5' CAA…

A: Amino acid are molecules which are combine to form a protein molecules.Amino acid are synthesized by…

Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first…

A: The deoxyribonucleic acid (DNA) is the hereditary material that transmits the genetic information…

Q: Compare the two mRNA sequences below. AUAUUCGGCAAUCCG AUAUUCCGCAAUCCG This change could be the…

A: Messenger RNA or mRNA is single stranded RNA which acts as template for the synthesis of amino acids…

Q: Which, if any, of the following sequences cannot exist for a mRNA. Explain your answer. UUUUUU…

A: Instructions for construction of proteins is done in 2 steps- transcription and translation.…

Q: List anticodon sequences on the tRNA’s carrying the amino acids: Ala, Phe, Leu, Tyr

A: In the process of translation, the mRNA-carrying codons are coded into the anticodons, which help to…

Q: Describe the sequence in bacterial mRNA that promotes recognition by the 30S subunit.

A: RNA or ribonucleic acid is a polymer of ribonucleotides connected together via a phosphodiester…

Q: Does crude mRNA have density? if so what is the density value ? Thank You

A: Introduction mRNA is single stranded RNA. Which carries genetic information from DNA to ribosomes…

Q: What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap…

A: The predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap and 3’…

Q: Draw the SMN2 pre-mRNA (10 exons and 9 introns), indicate the 5’ and 3’ SS location. Draw the SMN2…

A: Proteins are obtained from DNA that contains the required genetic information. DNA is first…

Q: What is the molecular weight of an mRNA that codes for the protein of molecular weight 75000KD?…

A: The translation is a process in which protein gets synthesized from mRNA template. It occurs in 3…

Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. What…

A: The process of formation of mRNA from template DNA sequence is known as transcription. The process…

Q: The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’…

Q: Define messenger ribonucleic acid (mRNA)

A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…

Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second…

A: The mRNA (messenger ribonucleic acid) is synthesized from a DNA (deoxyribonucleic acid) template.…

Q: The following is the only intron sequence of a gene that will be excised during the maturation of…

A: In science, a gene is an essential unit of heredity and a succession of nucleotides in DNA or RNA…

Q: Which of the following is the MRNA coding for the peptide trp-met-gly- ser-his? A.…

A: The genetic codes are the sequence of nucleotide that governs the formation of proteins.

Q: Write a possible sequence for an mRNA segment coding for apamine

A: Introduction Genome is referred to the total amount of DNA a single haploid cell contains. Genome…

Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…

A: An open reading frame in molecular genetics describes the part of your reading frame that has the…

Q: give the amino acids specified by the following bacterial mRNA sequences. a. 5′…

A: In the given question, the bacterial mRNA sequence is given for which we have to find the amino…

Q: How long is the polypeptide produced from the following mRNA transcript?…

A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…

Q: In which reading frame will this mRNA be read? 5'- ACAG C C U G CA A GU C A CU GACG- 3' O 1st O 2nd…

A: The order of amino acids in a protein from the N-terminus to the C-terminus is specified by mRNA…

Q: Name and explain the process by which mRNA is formed.

A: Gene expression is the process by which information which is contained in genes is decoded to…

Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…

A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: Name and describe three types of modification that the mRNA undergoes in eukaryotes before the MRNA…

Q: Translate the following mRNA into protein, starting from the first initiation codon:…

A: Translation is the process of synthesis of protein from an mRNA. mRNA synthesized through…

Q: Complete the complementary strand: mRNA transcription ATTCGAGGCTAA

A: The ribonucleic acid (RNA) molecule involves the transfer of the genetic information from the…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: Francis crick proposed the central dogma, which states that the DNA is replicated. This DNA is used…

Q: Define the pre-mRNA & mRNA spliceforms of Mutuallyexclusive exons ?

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…

Q: Consider the following mRNA base sequence 5' CUU CAG 3 a What dipeptide is coded for this mRNA?…

A: Genetic codes are unambiguous that means one codon will code for only one amino acid. Codons are…

Q: How many amino acid are in each of the two polypeptides produced? And how many nucleotides long…

A: The amino acids are produced by the DNA (deoxyribonucleic acid) through processes called…

Q: Write the codons for the following amino acids. 1. Phe 2. Val

A: Genetic codon: - It is the 3 nucleotide sequence of DNA and RNA, all bases are involved in formation…

Q: Determine which amino acid is formed from the following mRNA codon: GUA. a aspartic acid b…

A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…

Q: The following is the only intron sequence of a gene that will be excised during the maturation of…

A: Prokaryotes have simpler cellular organization and gene structure when compared to eukaryotes.…

Q: Identify the secondary structures present in the protein and its genes code…

A: Proteins are large biomolecules that compose structural and motor elements of a cell, and also as…

Q: How many amino acids are coded for by the following mRNA: 5…

A: From the DNA, genetic information is transcribed in the form of codons. These codons reside in the…

Q: what is the difference between leader mRNA and attenuator sequence? Please explain the function of…

A: Operon is a genetic regulatory system found in bacteria and their viruses in which genes coding for…

Q: Mhich of the following polypeptides is coded for my the MRNA sequence 5' AUGGUUAAACGACAAUCC 3 ?

A: The amino acids are selected and wrote in the sequence as first, second and third base. The process…

Q: UGGGCUGGUGCCGAGAAAGUUAGGUAA-3' What is the name of the sixth amino acid in the protein formed from…

Q: Draw a eukaryotic mRNA that has been fully processed. Label the key parts including the Kozak…

A: The eukaryotic RNA is formed from the eukaryotic DNA by the process of transcription.

Q: Assume that the following mRNA segment has been translated. 5’-UACCGAAUGUCU-3’ Note for…

A: Translation is the process during which codons in mRNA are identified by tRNA with specific…

Q: Given the following MRNA sequence, what is the amino acid sequence of the polypeptide that will be…

A: The mRNA is read in the 5' to 3' direction by the transcription machinery to produce the polypeptide…

Q: Identify the different regions of the mature mRNA by matching terms with regions. A В AUG UGA сар…

A: Mature mRNA or mature transcript is the RNA present in eukaryotes which consists of exons with all…

Q: For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table…

A: We are provided the mRNA sequence, and we need to write the amino acid sequence formed.

Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…

A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…

Q: Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the…

A: Transcription is the process in which the synthesis of RNA takes place by using deoxyribonucleic…

Question

Provide the abbreviation for the amino acid sequence expected from the following mRNA segment using the
three-letter amino acid codes:
5' UUUICCCIAAUIAUUIACG 3'

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Compare bacterial and eukaryotic mRNAs, and explain the functional significance of their structural differences.
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?
The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
For each of the following mRNA sequences predict the appropriate protein sequence:a. AUGCGCCCCCAGUGACCACACb. AUGACAUGUGUAAACc. AUGAUAUCUAGACAA
For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference. 5' AGUCCGUAC 3' 5' AAUUGCUUC 3'
The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’
Determine the amino acid sequence for a polypeptide coded for by the following mRNA transcript (written 5'-> 3'): AUGCCUGACUUUAAGUAG
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
draw mRNA sequence for the following sequence ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG
Given the following mRNA sequence, what is the amino acid sequence of the polypeptide that will be produced in the cell? 5’ – CGAGGUAUGCCAACGUGCGUCUAAUCCCGA-3
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’