A.Give the transcript that will be formed from this template. 3- TACGGGTTATATTCAATC-5" B.Give the polypeptide formed after translation

Q: 8. The following diagram represents the Christmas-tree-like structures during transcript On the…

A: E. Eliminators are viewed downstream of the quality as deciphered, and ordinarily happen…

Q: When RNA polymerase transcribes DNA, only one of the two DNA strands is used as a template.…

A: Transcription is the process in which a DNA strand gets transcribes into RNA by the help of RNA…

Q: DNA synthesis has a very low error rate.  One reason for this is that the DNA polymerase enzyme can…

A: DNA polymerase is the enzyme that does maximum of the work throughout DNA replication. It builds a…

Q: a. Indicate whether point C is a 5' end or a 3' end of a nucleic acid. b. Indicate which strand…

A: The ribonucleic acid was the primary genetic material. It acts as a genetic material furthermore as…

Q: Some DNA polymerases have proofreading activities. After a nucleotide is added to a growing nucleic…

A: Ribosomes also have similar proofreading activities during translation.  The proofreading activity…

Q: Choose correct option and do explain plz.  1. The protein complex that helps RNA polymerase to…

A: a) SWI/SNF It is composed of various proteins and act as an ATP-dependent chromatin remodeling…

Q: How does the Cas9 endonuclease bind to specific sequences of DNA in order to make cuts?   A.  It…

A: Cas9 is a 160-kilodalton protein that plays a key part in certain bacteria's immunological defence…

Q: 2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU -- 3' Write the amino acid sequence…

A: The nucleotide sequence in mRNA is translated to an amino acid by rules of genetic code. A codon…

Q: The diagram below shows a section of double-stranded DNA undergoing both transcription and…

A: DNA replication is the process in which the DNA copies are made by the action of several enzymes…

Q: 26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The…

A: Protein synthesis takes place in two stages, namely, transcription and translation. Transcription is…

Q: xplain The mRNA codon of valine is: GUC UGG CCA TTG

A: Each codon in mRNA is made up of three nucleotides and represents a certain amino acid (hence, it is…

Q: 1b) Give the anticodon of the tRNA that would be complementary or a perfect match to the codon…

A: The codon is defined as a sequence of three nucleotide bases on messenger RNA responsible for…

Q: RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of…

A: During the process of transcription. RNA polymerase is the enzyme and its main function is to…

Q: Based on the "initial transcription by RNA polymerase proceeds through a DNA- scrunching mechanism"…

A: Introduction :- DNA molecule acts as the genetic material of the cell and also the repository of…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Multiple 3′ cleavage sites result in a. multiple genes of different lengths. b. multiple pre-mRNAs…

A: Multiple 3' cleavage sites produce different length of RNA transcript as they contain potential…

Q: A nonsense mutation Select one: a. results in a larger protein being produced from the mutated gene…

A: Introduction :- There are a number of disorders known to be caused by nonsense mutations, including:…

Q: Attached is a region of DNA containing a transcription unit. Match the boxes with the terms…

A: The DNA contained the genetic information that is transcribed into mRNA by the process of…

Q: Transcript the template DNA (write in mRNA codons) *

A: The synthesis of messenger RNA with the help of DNA is called transcription. The main enzyme of…

Q: 91 The mRNA Shine-Dalgarno sequence interacts with 26S rRNA anti-Shine-Dalgarno sequence. Yes or…

A: Transcription is the process of RNA synthesis from the DNA template. It occurs within the nucleus of…

Q: .  Locate the -10 region hexanucleotide sequence in the following coding strand of DNA.  Indicate…

A: Transcription is a process through which the template strand of the DNA transcribes into mRNA in the…

Q: a. Write the sequence of the MRNA synthesized from the upper strand. b. Indicate the 5'and 3'ends of…

A: Answer : a. Sequence of mRNA synthesized from the upper stand - 5' AUGCCAUUUUGA 3' b. 5' and 3' ends…

Q: 1. You are given with the DNA sequence in the leading strand template. See item number 1 in…

A: Since you have asked multiple questions , we will solve the first question for you. If you want any…

Q: Following is the nucleotide sequence in a segment of a strand of DNA 5'- AATTGGCTCTATAAT-3' Give the…

A: Adenine, thymine, guanine, and cytosine are the bases of the DNA. The mRNA is a single-stranded…

Q: Discuss the characteristic of DNA polymerase 1, Nick translation Proofreading

A: The heterocatalytic process by which a new DNA stand is synthesized on a old DNA template is known…

Q: UACTyrosine (Tyr) Fcysteine (Cys) Consider the following DNA coding strand: 5' - ATGTACGGC GAATAA-3'…

A: Within the biological system, the flow of genetic information is explained as molecular biology's…

Q: The heptapeptide repeat in the carboxy terminal domain (CTD) in the RPB1 subunit of RNA polymerase…

A: Answer :- Option (D) is correct. - Initiate transcription.

Q: nexose kinase gene's sequence can be found below, the +1 nucleotide is ed. It also contains an…

A: Replication occurs in three major steps: the opening of the double helix and separation of the DNA…

Q: Match Column A with Column B.…

A: transports amino acids to the site of protein synthesis- tRNA- tRNA is responsible for the transfer…

Q: A partial DNA sequence, a partial MRNA transcript, and part of the CFTR polypeptide in a cystic…

A: Cystic fibrosis is a disesase that damage the cell producing mucus, sweat and other juices.  in…

Q: Using the provided čoding strand below 5-ATCAGATGGCCGGGCCAATAGAATAGCTGT-3 Provide the anticodons…

A: DNA is two stranded ladder like structure which comprises of :-  A) Coding strand  B) Template…

Q: RNA polymerase from E. coli (core enzyme alone) has all of the following properties except:…

A: RNA polymerase enzyme is a multi subunit enzyme having a catalytically active core.

Q: 8 QUESTION: Transcribe the gene. Write out the correct sequence of mRNA bases. Notice that this is…

A: Transcription is the synthesis of RNA from DNA segment with the help of RNA polymerase enzyme. It…

Q: in a western blot how come changes in mrna levels don't always match the protein product of that…

A: The western blot:It is also known as the protein immunoblot. It is an extensively used analytical…

Q: Translate the protein that is expressed from this template DNA sequence. Transcription is going left…

A: Transcription is the process of formation of mRNA from a DNA transcript. It occurs ont he template…

Q: b) In eukaryotes, the newly synthesized mRNA undergoes modifications before it is transported across…

A: In eukaryotic cells, transcription is a process in which genetic information in the DNA is converted…

Q: 5'.GTCTCTTGACATTG... 3' What is the MRNA sequence transcribed from this sequence (assume the…

A: Ans ) Always Guanine codes for cysteine only .. That is G-C Given.…

Q: Write a note on post translational modifications. Draw a diagram as well.

A: Post-translational change alludes to the covalent and by and large enzymatic adjustment of proteins…

Q: 5' - ATGGCGAGGCGGCAGCTGTTATGGTGA – 3' In the sequence above, suppose that the 20th nucleotide of the…

A: The mRNA is produced from the template strand that is oriented in 3' to 5' direction and the newly…

Q: TACGGTACGATT CYTOPLASM Transcription a. On the diagram, draw a circle around the part that…

A:

Q: 5'--TTAATGGGACAGCTTGTGTAGAGG--3' a.) What is the complementary strand of DNA? b.) What is the…

A: A nucleotide is the basic building block of nucleic acids. Ribonucleic acid and Deoxyribonucleic…

Q: Telomerase adds six deoxynucleotides to the end of a DNA strand using a built-in RNA template.…

A: The ends of eukaryotic chromosomes are called telomeres, and they are composed of repeats of a…

Q: 6. The normal sequence a DNA and the MRNA transcribed from it are shown below. DNA-…

A: For the expression of a gene, the nucleotide sequences present in the template strand of DNA are…

Q: 1. Convert the sequence from DNA to Amino Acids. 3-TCACCACTCTGGTCTGGTCATATCTGCCTGATATGAGTACAT - 5'…

A: The translation is a process in which the synthesis of protein is done from the mRNA. The sequence…

Q: The gene encoding the E. coli enzyme enolase begins with the sequence ATGTCCAAAATCGTA. What is the…

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: Describe Information Transfr Replicetion - Transcuiption Tronslation

A: Genes and genomes play an important role in information processing. The genetic material of the cell…

Q: Given the sequence below, (A) What is the transcript (MRNA) sequence? (B) What is the amino acid…

A: DNA => Transcription => mRNA => Translation => Protein. Given DNA sequence: 5' ATG CTT…

Q: All about RNA editing A. changing one or more nucleotides in the RNA transcript by deamination B.…

A: In this question when we look at options then we don't need to check B and C options as it's in…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.