Identify the primary sequence for the polypeptide that yields these fragments upon treatment: His-met-thr-met-ala-trp; Leu-asn-asp-phe; Val-lys obtained from chymotrypsin Leu-asn-asp-phe-his-met; Ala-trp-val-lys; Thr-met obtained from CNB
Q: Which of the following would be considered a severe mutation? A) Leucine (Leu) > Lysine (Lys) B)…
A: Amino acids are classified based on their properties like whether they are polar or nonpolar,…
Q: A peptide was cleaved into two smaller peptides with cyanogen bromide (CNBr) and into two different…
A: The given peptide sequences are: CNBr 1: Gly-Thr-Lys-Ala-Glu CNBr 2: Ser-Met Tryp 1:…
Q: Hydroxylamine (NH2OH) converts cytosine to the compound shown below. With which base does this…
A: Transition mutation refers to a point mutation that changes a purine nucleotide to another purine or…
Q: Following the IUPAC rules for naming small peptides, assign a name for Leu–Lys–Trp–Met
A: Peptides are short chains of between two and fifty amino acids, linked by peptide bonds. Chains of…
Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,…
A: Small molecules called amino acids form the building blocks of proteins. In chemistry, an amino acid…
Q: Determine the mechanism and base change(s) which resulted in the alteration of the sequence of a…
A: In genetics, the mechanism of base change is defined as the change or replacement of DNA single base…
Q: Multisubunit proteins in which some or all of the subunitsare identical are referred to as…
A: Multisubunit proteins are considered as those proteins, which are composed of more than one protein.…
Q: What is the difference between a deoxynucleotide triphosphate (dNTP) and a dideoxynucleotide…
A: dNTPs are also called deoxyribonucleotide triphosphate. Each dNTPs are made up of a phosphate group,…
Q: A tridecapeptide yields the following fragments when partially hydrolized. Determine the sequence of…
A: A tridecapeptide is an oligopeptide having thirteen amino acid residues.
Q: A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin,…
A: Proteolytic cleavage is basically the process of breaking the peptide bonds between amino acids in…
Q: Given the polypeptide chain below: Ala-Arg-Val-His-Asp-Gln 1. What is the N-terminus? 2.What is…
A: The organic molecule is comprised of two functional groups that are an amino group and the carboxyl…
Q: A sample of an unknown peptide was dividedinto two aliquots. One aliquot was treated with trypsin;…
A: Trypsin is an endopeptidase. It is a serine protease that cleaves after the basic residues such as…
Q: What is the base sequence of the segment of DNA that is responsible for the biosynthesis of the…
A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…
Q: Define the term and describe the autoantibodies presentin SLE.
A: Antibodies are Y-shaped compounds produced in the body in response to foreign agents. These are…
Q: For each of the following sequences determine if they will most likely form an amphipathic α helix,…
A: Proteins are polymers of amino acids. The sequence of amino acids is governed by the sequences of…
Q: Show where trypsin and chymotrypsin would cleave the following peptide…
A: Amino acids are joined together by a peptide bond to form a polypeptide chain called protein.…
Q: What is meant by the binding problem, and what is necessary for binding to occur?
A: "The Binding Problem" is one of the most well-known open questions in computational neuroscience.…
Q: Which of the following could be the DNA template for the following protein primary structum…
A: The DNA is transcribed to produce the mRNA which gets translated into protein. Proteins are polymers…
Q: A heptapeptide when treated with trypsin produced two peptides. T1 (D, G, Y) and T2 (K, F, V, A).…
A: Peptide includes a short chain of amino acids that are connected to each other by peptide bond. A…
Q: After treating one polypeptide with two different proteases (Trypsin and Chymotrypsin), shorter…
A: Introduction Peptides are short chains of amino acids with peptide bonds connecting them.…
Q: A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly…
A: Trypsin and chymotrypsin are essential serine proteases that are secreted by the pancreas. They play…
Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,…
A: The primary structure of the protein refers to the amino acid sequence in the peptide. The amino…
Q: A solution of a peptide of unknown sequence was divided into two samples. One sample was treated…
A: Only twenty of the available amino acids are often present in proteins among all the possible amino…
Q: A polypeptide is digested with trypsin, and the resulting segments are sequenced:…
A: Introduction: A number of enzymes catalyze the breakdown of peptide bonds at a specific site in an…
Q: You are analyzing the peptide ala-ile-glu-lys-phe-val- tyr-cys. If you treat the peptide with…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: What is the isoelectric point of this fragment? DHVTHLRKMG
A: Here the given peptide is: DHVTHLRKMG…
Q: What is the name for Gly-Tyr-Leu-Val Sequence?
A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…
Q: Ile-Ala-His-Thr-Tyr-Gly-Pro-Phe-Glu-Ala-Ala-Met-Cys-Lys-Trp-Glu-Ala-Gln-Pro-Asp-Gly-Met-Glu-Cys-Ala-…
A: Most common secondary are the α-helix and the β-pleated sheet. Both the secondary structure is…
Q: Assume that the 3 polypeptide strands shown below form a parallel B-sheet. Select amino acids AA1,…
A: Beta sheet is one of type of secondary structure in which inter strand hydrogen bonds is formed…
Q: TNIS IS the SC TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT Write the amino acid sequence of the protein that…
A: Here DNA sequence is given is TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT This DNA strand work as a template…
Q: Two melanocyte-stimulating hormones have the following amino acid sequences. Take a highlighter or…
A: Conserved sequences are the amino acid sequence that remain identical between two or more species…
Q: A polypeptide is subjected to the following digestion procedures and the fragments are sequenced.…
A: For this question we just need to to know sites of Trypsin and Cynogen Bromide at which they act and…
Q: What fragments can be obtained from the treatment of Pro-Lys-Gly-Gly-Arg-Trp-His-Cys with trypsin…
A: The digestive enzymes trypsin and chymotrypsin are secreted by the pancreas as inactive enzyme…
Q: Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3' O…
A: Answer :- Met-ala-phe-lys-stop DNA…
Q: Which amino acid sequence will be generated? 5'-GAAUGUCUUCGUUAUUGAUGUAGAA-3'
A: During translation mRNA is translated into amino acid sequence, by the help of various enzymes, tRNA…
Q: what are the first 4 amino acids in the polypeptide sequence of SARS-CoV-2 surface glycoprotein
A: The coronavirus disease caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)…
Q: Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-LEU-LEU-SER DNA Sequence:…
A: Closer the DNA constitution of organisms closer are they in their protein content. One can determine…
Q: Suggest which part of this sequence belongs to the inner part of the protein and which to the outer…
A: Proteins are polypeptides formed of monomeric units-amino acids. There are 20 different amino acids…
Q: Irreversible cleavage of disulfide bridges is achieved by treating the protein with O a. Edman…
A: Asked : Irreversible Cleavage of disulfide bridges can be done by which of option
Q: The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a)…
A: The central dogma of molecular biology is the process of the formation of functional products by…
Q: A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin;…
A: Introduction Peptides Are Short Sequences of Amino Acid Monomers Joined by Amide Bonds That Occur…
Q: Consider the following protein sequence as an α helix:…
A: The sequence and identity of amino acids of a polypeptide chain make its primary structure.
Q: A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin…
A: Trypsin cleave the peptide on the carboxy side of arginine and lysine residues. Cyanogen bromide…
Q: In studies using repeating copolymers, AC . . . incorporates threonine and histidine, and CAACAA . .…
A: A protein's amino acid sequence is determined by the sequence of nucleotides in DNA and RNA. It is…
Q: Trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas…
A: Polypeptide is formed when amino acids are joined together with peptide bonds. Peptide bond is…
Q: Give the name of the base, the ribonucleoside or deoxyribonucleoside, and the ribonucleoside…
A: The RNA and DNA are the nucleic acids present in the cells . Both RNA and DNA consists of…
Q: Write the anticodons for the following amino acids: a) Met b) Trp c) Ser d) Leu
A: The codon is defined as a sequence of three RNA or DNA bases, which correspond with a specific amino…
Q: Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the…
A: The sequence are:
Step by step
Solved in 4 steps
- The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-Given the fragment Ala-Lys-Tyr-Gly-Phe and Leu-Val-Ser-His-Cys-Arg, what is the expected result in both fragments with CuSO4 and NaOH? a. dark violet solution b. light violet solution c. blue solution d. colorless solutionIle-Ala-His-Thr-Tyr-Gly-Pro-Phe-Glu-Ala-Ala-Met-Cys-Lys-Trp-Glu-Ala-Gln-Pro-Asp-Gly-Met-Glu-Cys-Ala-Phe-His-Arg What will be the secondary structure formed from this sequence?
- Treatment of a polypeptide by 2-mercaptoethanol yields two polypeptides that have the following amino acid sequences: Ala-Phe-Cys-Met-Tyr-Cys-Leu-Trp-Cys-Asn Val-Cys-Trp-Val-Ile-Phe-Gly-Cys-Lys Chymotrypsin-catalyzed hydrolysis of the intact polypeptide yields polypeptide fragments with the following amino acid compositions: (Ala, Phe) (Asn, Cys2, Met,Tyr) (Cys, Gly, Lys) (Cys2, Leu,Trp2,Val) (Ile, Phe,Val) Indicate the positions of the disulfide bonds in the original polypeptide.Treatment of a polypeptide by 2-mercaptoethanol yields two polypeptides that have the following amino acid sequences: Ala-Phe-Cys-Met-Tyr-Cys-Leu-Trp-Cys-Asn Val-Cys-Trp-Val-Ile-Phe-Gly-Cys-Lys Chymotrypsin-catalyzed hydrolysis of the intact polypeptide yields polypeptide fragments with the following amino acid compositions: (Ala, Phe) (Asn, Cys2, Met,Tyr) (Cys, Gly, Lys) (Cys2, Leu,Trp2,Val) (Ile, Phe,Val) Indicate the positions of the disulfide bonds in the original polypeptide. I don't understand how the order of amino acids in Step 2 was arranged. Please explain. Thank you.draw the structure of the peptide Asp - Asn-Ser-Lys-Pro at PH 8
- Consider the following protein sequence as an α helix: Leu-Lys-Arg-Ile-Val-Asp-Ile-Leu-Ser-Arg-Leu-Phe-Lys-Val. how many turns does this helix make?What is the name for Gly-Tyr-Leu-Val Sequence?A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide?
- A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide? (Recall that trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas chymotrypsin cleaves after aromatic amino acid residues).Is the peptide (written N-terminal to C-terminal) represented by Ala-Ser-Ala-Tyr the same as the peptide represented by Tyr-Ala--Ser-Ala? Explain.Determine the isoelectric point of the peptide product of the mutated sequence: 5' - AUG UCC AUG AUU CUG GAA AUU ACC UCC AUC AUG AAG CGC UGA CCC AUU AUU AA - 3'