Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. The nucleotides are numbered 1 to 100. NOTE: For this problem, transcription begins with and includes the red and underlined CIG (top strand/bottom strand) base pair and RNA polymerase proceeds from left to right along the DNA. 1 20 40 5'-GTGTCCGTCTAАТАТТGTGAGATGTТАТАТСССGCСGTCAАCАССАТСАА-3' --+-- --- --- --- --- 3'-САСAGGCAGATTATAACAСТСТАСААТАТAGGGCGGCAGTTCTGGTAGTТ-5' 60 80 100 5'-ACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC-3' --+----- +--- -+-- ---+--- ----+ 3'-тстссТАтТAGCGGACGAСССССTTTCСGССАСТТССАТТтССАСААСGG-5' a) Which strand is used as a template for transcription, the top or the bottom? b) Where would the promoter be relative to the start of transcription? c) What are the first 15 nucleotides of the resulting mRNA? Indicate the 5' and 3' ends of the mRNA. d) What are the first 5 amino acids translated from the resulting mRNA? Indicate the amino acids translated from the resulting mRNA. Indicate the amino (NH,) and carboxy (COO') termini of the protein

Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. The nucleotides are numbered 1 to 100. NOTE: For this problem, transcription begins with and includes the red and underlined CIG (top strand/bottom strand) base pair and RNA polymerase proceeds from left to right along the DNA. 1 20 40 5'-GTGTCCGTCTAАТАТТGTGAGATGTТАТАТСССGCСGTCAАCАССАТСАА-3' --+-- --- --- --- --- 3'-САСAGGCAGATTATAACAСТСТАСААТАТAGGGCGGCAGTTCTGGTAGTТ-5' 60 80 100 5'-ACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC-3' --+----- +--- -+-- ---+--- ----+ 3'-тстссТАтТAGCGGACGAСССССTTTCСGССАСТТССАТТтССАСААСGG-5' a) Which strand is used as a template for transcription, the top or the bottom? b) Where would the promoter be relative to the start of transcription? c) What are the first 15 nucleotides of the resulting mRNA? Indicate the 5' and 3' ends of the mRNA. d) What are the first 5 amino acids translated from the resulting mRNA? Indicate the amino acids translated from the resulting mRNA. Indicate the amino (NH,) and carboxy (COO') termini of the protein

Name: 3. Shown below is a double-stranded bacterial (E. coli) DNA sequence
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 3. Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein.Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3'right to left. The nucleotides are numb

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 3TYK

See similar textbooks

Similar questions

1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.
1. Which of the following initially comes directly in contact with the mRNA during translation? a. 60s + 40s b. 50s + 30s c. 40s + 30s d. 60s + 50s 2. Which of the following properties of DNA confers to the presence of 5' phosphate and 3' hydroxyl terminal? a. Double helix b. Polarity c. Complementary base pairing d. Resistance to alkali hydrolysis 3. Which of the following are constant throughout the entire nucleic acid structure? a. Sugar and Phosphate b. A-T + G-C c. A-U + G-C d. Deoxyribose and Ribose
1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
1. Using the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing cut fragments would appear. The linear uncut DNA is 640 base pairs in length. Insert an image below.
Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 1. In this given DNA, the top strand is the 5' to 3' strand and the bottom strand is the 3' to 5' strand. The bottom strand (3' to 5' strand) acts as the template for transcription. PLEASE EXPLAIN WHY. 2. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript. 3. Identify the polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. please answer the 3 questions, thank you so much!
4) Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered regions. The arrows indicate transcription initiation sites, "D" indicates a splice donor site, "A" indicates a splice acceptor site, and "An" indicates a polyadenylation signal. Indicate all the possible mRNAs that could be produced from this gene (you don't need to draw new schematics - just list the regions that would be included in each mRNA by number)
1. Which of the following statements about mRNA is correct?a. Eukaryotic mRNA is generally polycistronic while prokaryotic mRNA is monocistronic.b. Both prokaryotic and eukaryotic RNA is polycistronic.c. Both prokaryotic and eukaryotic RNA is monocistronic.d. Eukaryotic mRNA is generally monocistronic while prokaryotic mRNA is polycistronic. 2. Which of the following statements about leading and lagging strand synthesis is correct?a. The lagging strand can only be synthesized once the leading strand has been completedb. Lagging strand is synthesized is continuously while leading strand is synthesized fragment by fragment.c. Leading strand is synthesized is continuously while lagging strand is synthesized fragment by fragment.d. Okazaki fragments are used to synthesize the leading and lagging strands of DNA. 3. An intron of a gene had a G to T mutation on the 3’ splice site. What will happento this intron?a. The intron will not be spliced out but will not be recognized in the ribosome…
1. (a) Which of the following statements is TRUE? DNA polymerase moves in a 5 to 3 direction in proofreading and correcting synthesized DNA. RNA polymerase moves in a 5 to 3 direction in synthesizing mRNA. Ribosome moves in a 3 to 5 direction during translation. tRNA moves in a 3 to 5 direction during translation. (b) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base." missense mutation nonsense mutation silent mutation frameshift mutation
1. Which is the correct of mRNA strand if you have a tRNA of GCA-AUG-UCC-CGU? A. 5’-CGU-UAC-AGG-CCA-3’ B. 3’-CGU-UAC-AGG-CCA-5’ C. 5’-CGT-TAC-TGG-GCA-3’ D. 3’-CGT-TAC-TGG-GCA-5’ 2. Which is the correct amino acids using the mRNA strand of 5’-AUG-CAU-CAA-3’? A. MET-HIS-GLN B. GLN-HIS-MET C. MET-GLN-HIS D. HIS-MET-GLN
1. What is a consensus sequence? What are the components of RNA polymerase and what are their functions? 2. Describe the steps involved with transcription initiation.? Describe the steps involved with transcription elongation. 3. Describe the steps involved with transcription termination. A consensus sequence is a sequence of DNA,RNA, or protein that has aligned sequence.
3. The enzyme responsible for transcribing complementary DNA from mRNA is DNA Polymerase Reverse transcriptase RNA Polymerase Endonuclease 6. Sanger DNA sequencing relies on a method known as chain termination. Which molecule is used to terminate DNA chains to create molecules of all possible lengths covering the fragment to be sequenced? Deoxyribonucleotides Deoxyadenosine Deoxyguanosine Dideoxynucleotides
1. A region of DNA in a particular cell synthesizes a segment of RNA that is 174 bases long and in the form of a large palindrome. The RNA is transported to the cytoplasm and folds into a hairpin loop of double stranded RNA. In the cytoplasm, the hairpin loop is recognized by a double-stranded RNA cutting enzyme (dicer) and is cut into 21 BP lengths. When these 21 BP double stranded segments are combined with protein, they function by: Answer choices destroying specific mRNAs priming the synthesis of DNA sequences adding DNA to the chromosome ends (telomeres) acting as decoys for RNA degrading enzymes thus protecting the mRNAs present splicing the introns out of messenger RNA 2. The following are genotypes of merozygotes of E. coli with various combinations of lac operon mutations. Determine the phenotype with respect to beta-galactosidase (z), permease (y), and trans-acetylase (a) of each combination as U = uninducible, I = inducible, and C = constitutive. Choose from…