Given this sequence: AUG TAT ACC GAG, which of the following would result in aframeshift mutation?AUG ACC GAGAUG TAA CCG AGAUG AAA ACC GAGO AGG TAT ACC GAG

Name: Given this sequence: AUG TAT ACC GAG, which of the following would re
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Given this sequence: AUG TAT ACC GAG, which of the following would result in aframeshift mutation?AUG ACC GAGAUG TAA CCG AGAUG AAA ACC GAGO AGG TAT ACC GAG

The sudden, inheritable, and stable alteration in the genetic material is said to be a MUTATION. The…

Answered: Given this sequence: AUG TAT ACC GAG,…

Science

Biology

Given this sequence: AUG TAT ACC GAG, which of the following would result in a frameshift mutation? O AUG ACC GAG AUG TAA CCG AG AUG AAA ACC GAG AGG TAT ACC GAG

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

Define and compare the following types of nucleotide substitutions. Which is likely to cause the most dramatic mutant effect? a. missense mutation b. nonsense mutation c. sense mutation
Consider this sequence below: GAG TAC ACG AGT GGA Which of the following options is an example of a non-synonymous point mutation? (remember to translate to mRNA!) A. GAG TAC AAT CGA GTG GA B. GAG TAC ACG GGT GGA C. GAG TAC A–G AGT GGA D. GAG TAC ACG AGA GGA
If the mutation causing Tay Sachs disease involves a C to T change at position 4 in the sequence AAGCGTTAGCTAGGCC, what probe would you use to detect the mutation in individuals concerned about carrying the disease?
⦁ Original: ATTTGAGCCMutated: ATTGAGCC. This is an example of what kind of mutation?
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
Based on the given description, determine which mutation is being referred to A single base substitution such as UCC --> UGC a. silent b. insertion c. deletion d. transversion e. nonsense f. transition
Suppose the codon sequence AUGACCCGGCUACUG has a single base pair mutation to AUGACCCGGUUACUG. If the old protein sequence was Met-Thr-Arg-Leu-Leu, what will be the new sequence encoded by the mutant gene?
Define FOUR (4) types of point mutations within coding sequences
For a specific type of mutation at a given location in a particular gene, identify whether it will affect the size of the mRNA, the protein, or both. How would the mutant appear on a gel in comparison to the original
. A mutational lesion results in a sequence containing amismatched base pair:5′ AGCTGCCTT 3′3′ ACGATGGAA 5′CodonIf mismatch repair occurs in either direction, whichamino acids could be found at this site?
Which of the following are safe havens for transposableelement insertions?a. Intronsb. Exonsc. Other transposable elementsd. a and c are both correct.
For each of the following sequences, rank them in order (from best to worst) as sequences that could be used to initiate translation according to Kozak’s rules. GACGCCAUGG GCCUCCAUGC GCCAUCAAGG GCCACCAUGG