In the space provided, write the polypeptide sequence obtained from the translation of the black allele gene. Second Letter Phe UCU UCC UCA UCG Tyr UUU U UUC UUA UUG UAU UAC UAA UAG UGU UGC UGA Stop A UGG Ser Stop Stop Leu Trp CGU CC CUU C CUC CUA CUG CCU Leu | ccc CCA CCG CAU CAC CAA CAG His C Arg CGA CGG Pro Gin 1st 3rd letter letter AAU AAC AAA AAG AGU AGC AGA AGG Asn Ser ACU ACC AUU A AUC AUA AUG lle Thr ACA Lys Arg Met ACG GAU GAC GAA GAG Asp GUU G GUC GUA GUG GCU GCC GCA GCG GGU GGC Gly GGA GGG Val Ala Glu UCACUCACUCAC UCAC
Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…
A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…
Q: The DNA sequence within the transcription unit of a gene is shown below. Important sequences are…
A: Transcription is the process which is responsible for making mRNA from the DNA by the action of RNA…
Q: If you set up an in vitro translation reaction containing poly(ACGU), as template, which of the…
A: A three-letter codon is a sequence of DNA or RNA that corresponds to a specific amino acid. These…
Q: UUU UUC UUA UCU) UCC UÇA UCG UAU Tyr UACS Phe UGU U Ser UGC Cys UUG Leu UAA Stop UGA Stop A UAG Stop…
A:
Q: Given the following genomic sequence which contains 2 exons and CDNA sequence predict the amino acid…
A: The introns are the non-coding parts of the premature mRNA that must be removed by…
Q: If the DNA gene reads AAT GGT CCA CCG CTG, what will the MRNA read? O A. TTA CCA GGT GGC GAC O B.…
A: DNA is a macromolecule and is composed of nucleotides having sugar , phosphate and nitrogenous bases…
Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…
A: Genetic code consists of four letters 'GACU' which stands for guanine, adenine, cytosine, and uracil…
Q: WILD-TYPE MC1R GENE (LIGHT COAT-COLOR PHENOTYPE) DNA GTG TAC GAA CGT mRNA Amino Acid
A: MC1R gene It provides instructions for making a protein called the melanocortin 1 receptor. This…
Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…
A: Answer : glycine, proline, alanine, arginine, The possible codons can be CCG CGC GCC GGC GCG CGG
Q: Identify the correct mRNA that will be produced from this NON-TEMPLATE or CODING strand: TAG CCG ATG…
A: The coding strand is the DNA strand whose base sequence is similar to its primary transcript (RNA).…
Q: Identify the mutation. Original DNA: TAC CCG AAT GGC ATT Mutated DNA TAC CCG AAC GGC ATT Use the…
A: To identify: The mutation in the given DNA sequence
Q: Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the…
A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure which act as genetic material in…
Q: The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3'…
A: Transcription is the process by which the information in a strand of DNA is copied into a messenger…
Q: What would the amino acid sequence be for the following DNA Transcript?…
A: DNA is the molecule that stores the information for the coding of the protein sequences in the human…
Q: If a point substitution mutation changes the sequence 5'ATGAAA3' to 5'ACGAAA3' in the MIDDLE of the…
A: Point mutation is a genetic mutation in which a single nucleotide base is altered, inserted or…
Q: Draw a line between the codons for each strand of MRNA: 1. AGGUCAUGCAUGGGCAUGCAU 2.…
A: BASIC INFORMATION GENETIC CODE These are the codes which helps in the formation of the protein…
Q: Given the following mRNA and amino acids, construct a polypeptide from this tRNA strand.…
A: This is the DNA which ultimately decides what amino acid sequences are going to be added to form a…
Q: Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ a) There are two…
A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part in transferring the…
Q: Without using your textbook, determine what protein sequence would be translated from the mRNA…
A: DNA is the store house of genetic information. This information is in the form of nucleotide…
Q: A section of template DNA has the following sequence of nitrogenous bases: 5’-CGATTACTG-3’. Which of…
A: Template DNA sequence - 5’-CGATTACTG-3’ After transcription the sequence - GCUAAUGAC Explanation -…
Q: Complete the DNA and RNA sequencing for the translation and creation of proteins. 1. DNA 3' CCC…
A: The genomic structure of an organism consists of DNA which contains sugar molecule, phosphate group,…
Q: How long is the polypeptide produced from the following mRNA transcript?…
A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…
Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…
A: Mutations are sudden heritable changes in the nucleotide sequence of a gene that changes the amino…
Q: The template strand of wild- type gene A is shown below. On the space provided, type the translation…
A:
Q: CUGACUGACUGA A template strand of DNA in a gene reads: TGG CTG GGT GCT ACA. GUCAGUCAGUCA Using the…
A: Firstly DNA template strand undergoes transcription process to form RNA. After that translation…
Q: A portion of the coding sequence of a cloned gene is shown…
A: The process of converting a DNA strand into mRNA is known as Transcription. The strand having the…
Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…
A: The flow of information from DNA to RNA is known as Transcription. (a) Transcription: It is a…
Q: A template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA. Using the codon chart provided, what…
A: The template DNA strand, from which the mRNA is synthesized is as follows, 5' ATGGCTGGGTGCTTTTAA3'…
Q: For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also…
A: Option 1 i.e. 5' AUA 3' is the correct answer.
Q: When researchers obtain genomic sequence data from organisms with little known genetic information,…
A: The central dogma of life includes the following processes: Replication: In this process, the DNA…
Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…
A: Mutation is in 3rd codon from 3' end. In wild type it codes for histidine while in mutant it codes…
Q: For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and…
A: Translation is a technique which refers to the process of translating mRNA sequence into amino acid…
Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…
A: If template sequence of the DNA is A.. mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA
Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…
A: DNA stands fo deoxyribonucleic acid. It is the genetic material.
Q: Need help to answer the following questions. Not sure if my answers are right.
A: DNA has a double helix structure. Both the strands are antiparallel that is if the one strand has 3'…
Q: These are portions of the coding strands of DNA for Wild-Type Hemoglobin and the mutated hemoglobin…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…
A: Given is a DNA template with a sequence and it consists of two exons and introns in it.Exons are the…
Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…
A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…
A: The amino acids are coded by the group of three bases called base triplets and codons.
Q: Here is a schematic map with a scale of a eukaryotic gene. How long is the primary mRNA transcript…
A: The mRNA is produced by the process of transcription.
Q: plz explain with thorough explanation
A: Introduction : The physical appearance of an organism such as colour, height, which occurs as a…
Q: For the codon sequence : 5’ GGA – AUA – UGG – UUC – CUA – 3’…
A: The translation is the process in which proteins are synthesized from the RNA. The ribosome and tRNA…
Q: You are a researcher studying a gene you think is responsible for super human strength. You call the…
A: The two primers that is the forward primer and the reverse primer gets attached to different ends of…
Q: A template strand of DNA in a gene reads: CCA AGC TCT. Using the codon chart provided, what is the…
A: Translation: Translation is the process by which ribosomes in the cytoplasm or endoplasmic…
Q: Given the following nucleotide sequence, 5’-CATTAGATCG-3’, find the correct complementary strand a.…
A: Nucleotides The bases found in the molecules of DNA are known as nucleotides. They are the building…
Q: please only answer part d and e
A: Cystic fibrosis is an autosomal recessive disorder, which affects lungs, digestive system and other…
Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…
A: CGA codes for Arginine. GGA codes for Glycine. Since the protein being coded for is completely…
Q: The following is a section of the gene coding for bovine rhodopsin along with several restriction…
A: Restriction endonucleases is a bacterial enzyme which cuts DNA strands in to fragments after…
Q: Use the codon chart to translate the following MRNA transcript into a protein. Please format your…
A: The synthesis of proteins with the help of m RNA is know as translation.
he question with gene sequence to predict amino acid sequence.
Step by step
Solved in 2 steps with 1 images
- Below is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?Based on these sequences. Remove codons 24 to 66, inclusive. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGIn the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash between each group of three bases. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG
- Place sequences a, b and c into the correct order based on start and stop codons. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence B TCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTC AATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTC GCGCCGAAAAAGATATGGgive the amino acids specified by the following bacterial mRNA sequences. a. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′ b. 5′ –AGGGAAAUCAGAUGUAUAUAUAUAUAUGA–3′ c. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′ d. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′For the following sequence design the forward and reverse primer... explain and justify your answer. Gene of Interest: a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg…
- Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF?
- Find 5’ UTR and 3’UTR of Mrna 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’what is the anticodon sequence that would build this protein? AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGUUGUAUUUGGUUUGUGGCGAGCGCUUUUACCAGUUAGAGAAUUACUGAmRNA sequence of A gene If we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17CàU 36GàA 49GàU 115AàC 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’