If the hydrolysis of 1 M glucose 6-phosphate catalyzed by glucose 6-phosphatase has a ΔG′∘ of −11.386 kJ/mol at 25 °C, what percentage of substrate remains once the reaction reaches equilibrium assuming no product was initially present? (Round answer to the nearest whole number)
Q: The Hb Yakima variation is caused by the mutation D99H, which results in a shift in oxygen binding…
A: Hemoglobin binds to oxygen and it appears in two state. The T state (tensed) and R state (relaxed).…
Q: Enzyme X exhibits maximum activity at pH = 6.3. X shows a fairly sharp decrease in its activity when…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: Identify if SN1, SN2 and so forth. Catabolism of triacylglycerols- beta-oxidation pathway…
A: SN1 and SN2 are common reactions in organic chemistry. SN1 is a two step reaction i.e., substitution…
Q: List the possible interactions in proteins that would affect ∆G.
A: The proteins must fold into its proper three dimensional structure in order to gain biological…
Q: Which of the following belong to the omega-6 fatty acid family? O CH3 - (CH2z - CH = CH - (CH2) -…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. If…
Q: What would be the standard free energy change if FADH 2 is used to reduce O 2 to water? Standard…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: Bacteria and other prokaryotic cells have the capacity to get more ATP/glucose oxidized than…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Some enzymes can catalyze a reaction involving NADH but cannot catalyze a reaction that uses NADPH.…
A: Since you have asked multiple questions we will solve the first question for you. If you want any…
Q: Nucleic Acid Chromatogram O O Nucleic acid chromatogram with nucleic acids circled in pencil 00
A: Chromatography is a biochemical technique that is used to separate closely related substances from a…
Q: Indicate whether the following pairs of monosaccharides are aldoses or ketoses. a. D-altrose &…
A: INTRODUCTION : Monosaccharides : They are also known as simple sugar. They are the simplest forms of…
Q: Suppose that the pH of distilled water is 6.2, what will be its resulting color using phenol red.
A: The pH of a solution refers to the H+ ion concentration in the solution. A solution with a pH lower…
Q: Enzyme X exhibits maximum activity at pH = 6.3. X shows a fairly sharp decrease in its activity when…
A: Most enzymes are proteins and proteins are primarily made up of amino acids. Amino acids bond with…
Q: Discuss how to determine the elements of proteins and its reactions.
A: Proteins are the most abundant biomacromolecule of life. Proteins are primarily polypeptide…
Q: Calculate the pI of the peptide KLMRDSP (pKa = 3.5, 3.9, 9.5, 10.0, 12.5).
A: The amino acids contain ionizable groups. The ionic form of these groups depends upon the pH of the…
Q: QUESTIONS: 1. Aside from carbohydrates, lipids and proteins, what other organic compounds are found…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: Hair is comprised largely of keratin, a fibrous protein consisting of two a-helices wrapped around…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: What is most correct about the following inhibition? Penicillin
A: The antibiotic penicillin irreversibly binds to and inhibits the activity of the transpeptidase…
Q: Would you expect the structure of a competitive inhibitor of a given enzyme to be similar to that of…
A: Enzyme inhibition is a process by which the activity of an enzyme is altered. Inhibitors are…
Q: H₂C-O-C-(CH₂) 16CH3 i HC-0- H₂C-O-C-(CH₂) 14CH3 (a) -(CH₂)7CH=CH(CH₂)7CH3 H₂C-O-C-(CH₂) 14CH3 요…
A: Fats and oils are triglycerides or triacylcylgerols. They are esters which three fatty acid are…
Q: phosphate. Contrast the properties of hexokinases I and IV with respect to oligomeric structure,…
A: Hexokinase is an enzyme that has the ability to transfer inorganic phosphate group from ATP to the…
Q: Gluconeogenesis occurs in muscle using the enzyme glucose-6-phosphatase. True False
A: The term "gluconeogenesis" describes a collection of metabolic processes that take place in the…
Q: A Benedict's test: (+) Seliwanoff's test: (-) Bial's-Orcinol test: (+) TLC Profile rib gal gic A B 0…
A: Carbohydrates A biomolecule with the empirical formula Cm(H2O)n that consists of carbon (C),…
Q: Two 0.9 mL aliquots of a serum are placed in two separate test tubes. These two test tubes are…
A: Method evaluation is a criteria by which we evaluate whether or not a new analytical technique meets…
Q: What compound of phosphorus is found in nucleic acids? What are the products of hydrolysis in RNA…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: Name the three major types of membrane lipids in animal cells and provide a specific example of…
A: The cell membrane is composed of lipids and proteins. A small amount of carbohydrates is also…
Q: Which form of fructose ,alpha or beta does take part in most biochemical reactions
A: Two-dimensional representation of cyclic structure of monosaccharides are called Haworth projection.…
Q: Which of the following is CORRECT? B) A "low energy compound" has a AG'° of less than -25 kJ/mol. C)…
A: catabolism and anabolism together referred to as metabolism. Breaking down if complex compounds to…
Q: Exergonic and endergonic biochemical reactions; the role of ATP and other macroergic substances in…
A: INTRODUCTION : ATP - Adenosine triphosphate, it is the main energy currency or units, which is…
Q: ATCase catalyzes the conversion of carbamoyl phosphate and aspartate into N-carbamoylaspartate, a…
A: Aspartate carbamoyltransferase is also known as aspartate transcarbamoylase or ATCase. It catalyzed…
Q: 385 What acts as a reductant in the glutamate synthase reaction to catalyze the transfer of the…
A: Reductant is a substance that donates electrons to another substance and reduce it. In an…
Q: What is expected theoretical number of copies of DNA molecules after 28 cycles in a PCR experiment?…
A: INTRODUCTION: DNA : Its fullform is Deoxyribo nucleic acid and It has a double stranded helix…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids:
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: 3. Use the structure shown below to answer the questions that follow: a b C. bottom. CH₂OH OH ) Name…
A: Carbohydrates are the important bio molecules that provide energy for the living organisms.…
Q: Definition of carbohydrate metabolic disorder. introduce other carbohydrate disorders along with…
A: Introduction: The term metabolism is the process by which our body makes energy from the food that…
Q: What explains the 10,000 to 1 selectivity of the potassium channel for K+ over Na+ considering that…
A: Channels are membrane proteins that allow biomolecules or ions to pass through them. Ion selective…
Q: Which of the following statements is/are FALSE about Bradford assay? 1. Upon addition of the…
A: Bradford Assay is an accurate spectroscopic analytical method to measure the concentration of total…
Q: All enzymes have an optimal temperature and pH environment. Choose how the following changes might…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: Calculate 1/[S] and 1/V to complete the table. Use this data to draw a Lineweaver-Burke plot, with…
A: A Lineweaver-Burk plot represents the relationship between the reciprocal values of substrate…
Q: Formation of a GC-rich stem-loop in the mRNA is required for function of an intrinsic transcription…
A: Transcription is the process in which mRNA corresponding to a gene is synthesized by RNA Polymerase.…
Q: What is binding energy? What do negative and less negative energies represent? How does this relate…
A: Binding energy is the amount of energy required to separate a system into its constituents. If we…
Q: How many reduced molecules (NADH, FADH2, NADPH) will be generated by converting lineoleic acid…
A: The fats are stored in eukaryotes as triglycerides that are broken down using the enzyme Lipase to…
Q: The PI of protein P is 7.3. One can purify protein P by:
A: The proteins are composed of twenty naturally occurring amino acids that are linked vis peptide…
Q: 4. A single base addition and a single base deletion approximately 15 bases apart in the mRNA…
A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…
Q: Please help me with finding the hypotheses that are being testing in each of the three enzyme…
A: Starch is a storage-type homopolysaccharide that contains two types of glucose polymers: amylose:…
Q: Why might the compound shown below act as a transition state analog of phosphoglucose isomerase? A…
A: Phosphoglucose isomerase (PGI) is an enzyme belongs to class of isomerase enzyme which catalyzes…
Q: Show how the addition of a competitive inhibitor would affect the reaction velocity and…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. They contain an…
Q: 3. (a) The beakers below represent different conditions for measuring the initial velocity (vo) of…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: Given that the reduction potential Eo'= -320, +10, +816, and +50mV for NAD+, fumarate, O₂ and…
A: An oxidizing species is the substance that donates electrons, and a reducing species is the…
Q: The diagram to the right illustrates the inter-actions of the amino acid side chains of two…
A: Coiled coils are super secondary structures formed as 2 or more alpha helices twist around each…
Q: Mnemonic about the UREA CYCLE that is not from the internet. Thank you.
A: Urea cycle is also known as the Ornithine cycle. In urea cycle urea is produced from ammonia. Urea…
If the hydrolysis of 1 M glucose 6-phosphate catalyzed by glucose 6-phosphatase has a ΔG′∘ of −11.386 kJ/mol at 25 °C, what percentage of substrate remains once the reaction reaches equilibrium assuming no product was initially present? (Round answer to the nearest whole number)
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- If a 0.1 M solution of glucose 1- phosphate at 25 °C is incubated with a catalytic amount of phosphoglucomutase, the glucose 1-phosphate is transformed to glucose 6-phosphate. At equilibrium, the concentrations of the reaction components are Calculate Keq and ΔG′° for this reaction.The standard free energy change for the reaction catalyzed by phosphoglucomutase is -7.1kJ/mol, (a) calculate ΔG at 37°C when the concentration of glucose-1-phosphate is 1-mM and the concentration of glucose-6-phosphate is 25-mM, (b) Is the reaction spontaneous under these conditions?Calculate the standard free-energy change of the reaction catalyzed by theenzyme phosphoglucomutase, given that, starting with 20 mM glucose 1-phosphate and no glucose 6- phosphate, the final equilibrium mixture at 25 °C and pH 7.0 contains 1.0 mM glucose 1-phosphate and 19 mM glucose 6-phosphate. Does the reaction in the direction of glucose 6-phosphate formation proceed with a loss or a gain of free energy?
- The Keq (25C) of the reaction below is 635.67. Fructose 1,6-biphosphate <-->fructose -6-phosphate + Pi. a) What is the standard Gibbs free energy change for this reaction? b) if the concentrationof fructose 1,6 biphosphate is adjusted to 0.85 M and that of fructose 6 phosphate and phosphate adjusted to 0.055 M, what is the actual free energy changeIf a reaction has a ΔG°′ value of at least −30.5 kJ · mol−1, suffi -cient to drive the synthesis of ATP (ΔG°′ = 30.5 kJ · mol−1), can it still drive the synthesis of ATP in vivo when its ΔG is only −10 kJ · mol−1? Explain.At body temperature (37°C), k of an enzyme-catalyzed reaction is 2.3X10¹⁴ times greater than k of the uncatalyzed reaction. Assuming that the frequency factor A is the same for both reactions, by how much does the enzyme lower the Eₐ?
- Consider the following equilibrium at 25ºC :Glucose-1-Phosphate Glucose-6-PhophateUsing the equilibrium concentrations of [Glucose-1-Phosphate] = 0.35 M and [Glucose-6-Phosphate] = 1.65 M, calculate BOTH K′eqand Gº′ for this reaction. Is this reaction exergonicor endergonic? R = 8.314 J/K·molThe phosphoryl group transfer potentials for glucose-1-phosphate and glucose-6-phosphate are 20.9 kJ/mol and 13.8 kJ/mol, respectively. (a) What is the equilibrium constant for the reaction shown below at 25 °C? (b) If a mixture was prepared containing 1 m glucose-6-phosphate and 1 x 10-3 M glucose-1-phosphate, what would be the thermodynamically favored direction for the reaction?Given that the standard free-energy change for the reaction glucose + Pi →glucose 6-phosphate is 13.8 kJ/mol, and the standard free-energy change forthe reaction ATP → ADP + Pi is −30.5 kJ/mol, what is the free-energychange for the reaction glucose + ATP → glucose 6-phosphate + ADP?
- At what substrate concentration would an enzyme with a kcat of 25.0 s-1 and a KM of 3.5 mM operate at 25% of its maximal rate? How many reactions would the enzyme catalyze in 45 seconds when it is fully saturated with substate, assuming the enzyme has one active site?A bacterial enzyme catalyzes the hydrolysis of maltose as shown in the reaction given below: Maltose + H2O -> 2 glucose If the reaction has a Km of 0.135 mM and a V max of 65 m mol/min. What is the reaction velocity when the concentration of maltose is 1.0 mM?An enzyme catalyzes a reaction at a velocity of 20 μmol/min when the concentration of substrate (S)is 0.01 M. The Km for this substrate is 1 × 10-5 M. Assuming that Michaelis-Menten kinetics arefollowed, what will the reaction velocity be when the concentration of S is 1 ×10-6 M?