Answered: Which of the following codons in an…

Which of the following codons in an MRNA can be recognized by the tRNA with UAA anticodon sequence (5-UAA-3)7 OA LRAG ARG-3) OLUUC IS UC-3) non sionn AUU S AUU 3

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 7TYU: Which of the following is/are not found in a bacterial mRNA molecule? (a) stop codon (b) upstream...

See similar textbooks

Related questions

Q: Small ribosomal sub-unit MRNA Codon Large Ribosomal sub-unit Amino acid Anticodon A C. D. F Three…

A: Nucleus is main controller of the cell which carries genetic material . It also contain thread like…

Q: How many different mRNA sequences can encode a polypeptide chain with the amino acid sequence…

A: Polypeptide chain includes a sequence of amino acids that are coded by different codons during the…

Q: What amino acid is coded for by each codon? a. GCC b. AAU c. CUA d. AGC e. CAA f. AAA

A: GCC -Alanine AAU - Asparagine CUA - Leucine AGC- Serine CAA - Glutamine AAA - Lysine

Q: TRACE THE CODE| Order of bases in MRNA (codon) AUC Order of bases in ERNA (anticodon) Order of bases…

A: Complete this table of codes.

Q: If the DNA sequence is ATG-CGT, the mRNA codons are ___. ATG-CGT UAC-GCA GUA-CGU AUG-CGU…

A: DNA full form is deoxyribonucleic acid. DNA is the main constituent of the chromosome. It contains…

Q: Shown below is a codon in an mRNA. What is the correct sequence of the tRNA anticodon that…

A: The given messenger ribonucleic acid (mRNA) codon 5’-CAG-3’ codes for the amino acid glutamine.…

Q: 70. Which of the following codes for the stop codon in mRNA? A.UUC B.UGA C.AUG D.AAA

A: Answer B) UGA

Q: Isoleucine is encoded by three codons (5')AUU, (5')AUC, and (5')AUA. These three codons are…

A: Wobble hypothesis: This hypothesis was given by Francis Crick. According to this hypothesis the…

Q: A certain mRNA strand has the following nucleotide sequence: 5'—AUG—ACG—UAU—AAC—UUU—3' What is the…

A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…

Q: The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT Give the mRNA…

A: Answer: CENTRAL DOGMA : It is the complete process of replication of DNA , transcription of DNA and…

Q: Codons are found on __________ and they contain __________ bases. a. tRNA, 4 b. mRNA, 3 c. tRNA, 3…

A: Codons are found on mRNA and they contain 3 bases. The genetic code is the stored genetic…

Q: When a ribosome reads a codon onmRNA, it must bind to the ____________of acorresponding tRNA.a.…

A: Protein synthesis involves two processes known as transcription and translation. In transcription,…

Q: A portion of a strand of a much longer molecule has a nucleotide sequence of AGCAGGCAGATC. During…

A: Translation, in molecular biology and genetics, is the mechanism by which ribosomes in the cytoplasm…

Q: list the amino acid sequence that would be made in a ribosome using these codons: AUG CUA AGU…

A: A ribosome consists of two basic pieces of units containing a large and a small subunit. During the…

Q: What is the anti-codon in tRNA that corresponds to the codon pGpCpA in MRNA? А. рТрGpC В. рСpGpT С.…

A: During replication and transcription a nucleic acid was copied from another nucleic acid. Hence this…

Q: Which of the following codons is called the start codon?

A: AUG is the Start codon, which codes for Methionine.

Q: Which of the following MRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: The mRNA is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene.…

Q: Consider the wobble rules listed in Table 15.2. An MRNA has the stop codon 5' UAA 3'. What TRNA…

A: Codon is a triplet of nucleotide base pairs.

Q: An MRNA has the codon 5' GUA 3'. What tRNA anticodon will bind to it ? A) 5' CTA 31 B) 5' ATC 3' C)…

A: DNA replication is the process of formation of identical copies of DNA. It occurs in the nucleus of…

Q: Which of the following is located at the C-terminus of a newly synthesized eukaryotic proteins?…

A: Initiation of translation occurs when the small ribosomal subunit binds with initiation factors and…

Q: Which of the following nucleotide triplets best represents a codon?

A: Introduction:- A codon is a triplet of bases (or nucleotides) in the DNA coding for one amino acid.…

Q: The anticodon loop of one of the t RNA Gly molecules from Escherichia coli is as follows: C--G G--C…

A: tRNA is a specialised RNA molecule that transports the amino acids during translation. A tRNA is…

Q: 1. A tRNA has the anticodon sequence: 5'-IGC- 3'. which codon will not decipher with this tRNA? a)…

Q: During initiation of translation, a is positioned first at the…

A: The translation is the process of synthesis of proteins that occurs on the ribosomes in the…

Q: If the MRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3', then what is the corresponding…

A: Transcribing tRNA from mRNA, mRNA tRNA U A G C A U C C The above table can be used for…

Q: Which of the following is the anti-codon present on the t-RNA that carries fMet to the start codon?…

A: a. The start codon is the first codon of a messenger RNA transcript that is translated by a…

Q: The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase…

A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: The tollowing mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA…

A: Protein consists of amino acids linked by amide bonds or peptide bonds.

Q: Assume that the nucleotide at the 5′ end of the first tRNA’s anticodon (the tRNA on the left) in…

A: The 61 codons codes code for 20 different amino acids. So, there must be 61 different tRNA…

Q: Which of the following codons is called the start codon? a.UAA b.UGA c.UAG d.AUG

A: The connection between the series of nucleotide on mRNA and series of amino acid in the polypeptide…

Q: In bacterial mRNA, the initiating AUG codon is preceded several nucleotides away by a purine-rich…

A: Translation is the process by which a polypeptide is formed using an mRNA as its template.…

Q: AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons…

A: Introduction When DNA makes the same copy of itself then it is called replication. Each replicated…

Q: The following sequence represents triplets on DNA:TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA…

A: Hello, thank you for your question. The second part of the question seems to be incomplete,…

Q: If the codon for Histidine is 5' CAU 3' in an MRNA molecule, the anticodon on the TRNA is: UAC ATG…

A: In every group of messenger ribonucleic acid (mRNA), there are three bases. A codon is also there…

Q: A series of tRNAs have the following anticodons. give all possible codons with which each tRNA can…

A: Anticodon relatable term with another term which is codon. A codon is a three-nucleotide stretch of…

Q: is the term used to describe the genetic coce because the rules net relate the nucleotide sequence…

A: Ans 1:- Universal is the term used to describe genetic code being same for most organisms.

Q: The first nucleotide in mRNA that will be synthesized from DNA below is: 3'-…

A: During the transcription process RNA is produced from the DNA within the nucleus of eukaryotic cells…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The diagram illustrates the process of elongation of polypeptide chain by adding amino acids one by…

Q: A single base substitution mutation is likely to have a less harmful effect when the base change…

A: A single base substitution mutation is also known as the point mutation which changes a single base…

Q: A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon…

A: ANSWER;- 3'UCA 5' Explain;- Transcription is a process of a particular DNA sequence being copied…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA consists of two intertwined polynucleotide strands: coding strand and template strand. The…

Q: What is the tRNA triplets codon that would fit the mRNA- 5' AUG AUC UAU GGG CCA AUU GCA UGA 3'

A: The three triplets which are complementary to the mRNA sequence forms the anticodon in transfer RNA.…

Q: during translation, each codon on the mRNA complementary base pairs with an snticodon on.....

A: Translation is the process in which proteins are synthesized by ribosomes.Translation occurs after…

Q: Which of the following changes to a DNA sequence would cause a frameshift mutation? OA. The…

A: Mutation are the changes that arise due to abrupt change in sequence of base pairs. It may be a…

Q: 8. Codons are sequences that correspond to specific amino acids or signals during protein…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: An amino acid sequence reads:N—Met-Gln-Leu-Arg-Cys—C Write out one possible mRNA sequences with a…

A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…

Q: Which of the following would not be found in a mature mRNA in a eukaryotic cell? A Star Codon B…

A: Select the component that is not present in mature mRNA of eukaryotic cells. The given options areA.…

Question

Which of the following codons in an MRNA can be recognized by the tRNA with UAA anticodon sequence (5-UAA-3?
DA LRAG (SANIG 3)
DUIA (SUUA)
OUUC IS UUC-)
ALU AURU.3)

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

Answer and explanation

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
In the gene-coding sequence shown here, which of the following events will produce a frameshift after the last mutational site? a. insertion of an A after the first codon b. deletion of the second codon (AAA) c. insertion of TA after the second codon and deletion of CG in the fourth codon d. deletion of AC in the third codon
Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the preceding
If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. five
Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Which of the following is/are not found in a bacterial mRNA molecule? (a) stop codon (b) upstream leader sequences (c) downstream trailing sequences (d) start codon (e) promoter sequences
An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon, what is the third amino acid of the translated polypeptide?
An anticodon has the sequence GCG. What amino acid does this tRNA carry? What would be the effect of a mutation that changes the C of the anti-codon to a G?
A tRNA's anticodon binds to the RNA sequence: 5'-CUA-3'. What is the sequence of the tRNA's anticodon?*Hint: The codons below do not need to be read from left to right. Use the 5' and 3' directionality to pick out which of the following is the correct answer.
The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start codon, what is the third amino acid incorporated into the polypeptide chain?
if the codon for Leucine is 5'-CUG-3'. what is the sequence of the corresponding anticodon on the tRNA-Leu? 5'-CUG-3' 3'-GAC-5' 3'-CUG-5' 5'-GAC-3'