c) A gene in a bacteria has the following DNA sequences (the promoter sequence ispositioned to the left but is not shown):5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3'3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5'i) By referring to the codon table below, write the corresponding mRNA transcript andpolypeptide translated from this DNA strand.2Second letterсAUUUPheUAUTyrUAC.UGUUGCJUCU)UCCUCAUUG Leu UCGCysUUCUUASerUAA Stop UGA Stop AUAG Stop UGG Trp GCUUCÚCCCUСССCAUCGUHisСАCProCCCỦALeuССАCAAArgCGACUG JCCG)CAG GinCGGAUUACUAAUAsnAGUSerAUC leАСCАCАAACAAAAGC.ThrJArgAUAAGAAUG Met ACGAAG LysAGG.GAUAspGUU)GCUGCCGCAGCGGGU"GGCGGAGGGGUCValGUAGACAlaGlyGAAGluGAGJGUGii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation thatresulted in deletion of the C:G base pair, what will be the resulting amino acid sequencefollowing transcription and translation?Third letterDUAGDUAGDUAGA.First letter

Name: c) A gene in a bacteria has the following DNA sequences (the promoter
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: c) A gene in a bacteria has the following DNA sequences (the promoter sequence ispositioned to the left but is not shown):5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3'3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5'i) By referring to the codon table b

Introduction :- In moelcular biology , the expression of gene is the most important event , that…

Science

Biology

c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3-GTTAGTACCT ТАCGGTACGAAGTATACTTАТCAAСTGTА-S' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. Second letter A G UAU Tyr UGC }cys UCU) UCC UCA UUG Leu UCG) UGU Phe UUC F UAC UAA Stop UGA Stop UAG Stop UGG Trp G Ser UUA CCU ССС CCA CG CUU CUC CỦA CAU His САС Pro CAA CGU CGC Arg Leu CGA Gin CG. CUG CAG AGU ser AGC AGA AAUAsn AUU AUC lle AUA AUG Met ACG ACU АСC ACA AAC Thr AAA AAG JLYS AGG JArg }Lys GCU GCC GCA GCG GGU GGC GGA GUU GAU1 Asp GAC GUC Val GUA Gly Ala GAA Glu GUG GAG, GGG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? DUAG Đ CAG Third letter DUAG UCAG 2. First letter

c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3-GTTAGTACCT ТАCGGTACGAAGTATACTTАТCAAСTGTА-S' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. Second letter A G UAU Tyr UGC }cys UCU) UCC UCA UUG Leu UCG) UGU Phe UUC F UAC UAA Stop UGA Stop UAG Stop UGG Trp G Ser UUA CCU ССС CCA CG CUU CUC CỦA CAU His САС Pro CAA CGU CGC Arg Leu CGA Gin CG. CUG CAG AGU ser AGC AGA AAUAsn AUU AUC lle AUA AUG Met ACG ACU АСC ACA AAC Thr AAA AAG JLYS AGG JArg }Lys GCU GCC GCA GCG GGU GGC GGA GUU GAU1 Asp GAC GUC Val GUA Gly Ala GAA Glu GUG GAG, GGG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? DUAG Đ CAG Third letter DUAG UCAG 2. First letter

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 10QP: The pre-mRNA transcript and protein made by several mutant genes were examined. The results are...

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the preceding
The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never made
An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bp
The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?
What will be the overall anti-codon sequence in tRNA for this mRNA? 5’-GUAGCCUUAUCUAGCGAUCACCGUCCGUAUUACUAGUGGCCAGACUCUUUUCACCAUGUAUAGUUG-3’
The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ How many amino acids are in the peptide encoded by the gene? _____________
An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’
The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ Draw boxes around any structures or bases that were added to the RNA during processing.
Translate the following mRNA into protein, starting from the first initiation codon: 5'-CCGAUGCCAUGGCAGCUCGGUGUUAC AAGGCUUGCAUCAGUACCAGUUUGAAUCC-3'
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.