In E. coli, a variety of mutator strains have been identified inwhich the spontaneous rate of mutation is much higher than innormal strains. Make a list of the types of abnormalities thatcould cause a strain of bacteria to become a mutator strain. Whichabnormalities do you think would give the highest rate of spontaneousmutation?

In E. coli, a variety of mutator strains have been identified inwhich the spontaneous rate of mutation is much higher than innormal strains. Make a list of the types of abnormalities thatcould cause a strain of bacteria to become a mutator strain. Whichabnormalities do you think would give the highest rate of spontaneousmutation?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
Over a period of several years, a large hospital kepttrack of the number of births of babies displaying thetrait achondroplasia. Achondroplasia is a very rareautosomal dominant condition resulting in dwarfismwith abnormal body proportions. After 120,000births, it was noted that 27 babies had been born withachondroplasia. One physician was interested in determining how many of these dwarf babies resultedfrom new mutations and whether the apparent mutation rate in this geographical area was higher thannormal. He looked up the families of the 27 dwarfbirths and discovered that four of the dwarf babieshad a dwarf parent. What is the apparent mutationrate of the achondroplasia gene in this population? Isit unusually high or low?
When 1 million cells of a culture of haploid yeastcarrying a met− auxotrophic mutation were plated onpetri plates lacking methionine (Met), five coloniesgrew. You would expect cells in which the originalmet− mutation was reversed (by a base change back tothe original sequence) would grow on the media lackingmethionine, but some of these apparent reversions couldbe due to a mutation in a different gene that somehowsuppresses the original met− mutations. How wouldyou be able to determine if the mutations in your fivecolonies were due either to a precise reversion of theoriginal met− mutation or to the generation of a suppressor mutation in a gene on another chromosome?
A mutant strain of bacteria is isolated in which the amino acid glutamine is often erroneously substituted for glutamic acid during protein synthesis. What kind of mutation might be underlying this defect? How could you test this hypothesis?
You are studying mutations in a bacterial gene thatcodes for an enzyme whose amino acid sequence isknown. In the wild-type protein, proline is the fifthamino acid from the amino terminal end. In one ofyour mutants with nonfunctional enzyme, you find aserine at position number 5. You subject this mutant tofurther mutagenesis and recover three different strains.Strain A has a proline at position number 5 and actsjust like a wild-type strain. Strain B has tryptophanat position number 5 and also acts like wild type.Strain C has no detectable enzyme function at anytemperature, and you can’t recover any protein thatresembles the enzyme. You mutagenize strain C andrecover a strain (C-1) that has enzyme function. Thesecond mutation in C-1 that is responsible for therecovery of enzyme function does not map at theenzyme locus.a. What is the nucleotide sequence in both strands ofthe wild-type gene at this location?b. Why does strain B have a wild-type phenotype? Whydoes the original mutant with…
what are disease-causing mutations? Explain with suitable exaamples
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
Two types of mutations discussed in this chapter are (1) nucleotide changes and (2) unstable genome regions that undergo dynamic changes. Describe each type of mutation.
What type of mutation is shown in the diagram? Why do you think this type of mutation is referred to by this term?
What are the chances of occurence of amorphic mutation?
The following is a list of mutations that have beendiscovered in a gene that has more than 60 exons andencodes a very large protein of 2532 amino acids.Indicate whether or not each mutation could cause adetectable change in the size or the amount of mRNAand/or a detectable change in the size or the amountof the protein product. (Detectable changes in size oramount must be greater than 1% of normal values.)What kind of change would you predict?a. Lys576Val (changes amino acid 576 from lysineinto valine)b. Lys576Argc. AAG576AAA (changes codon 576 from AAG toAAA)d. AAG576UAGe. Met1Arg (at least two possible scenarios exist forthis mutation)f. promoter mutationg. one base pair insertion into codon 1841h. deletion of codon 779i. IVS18DS, G–A, + 1 (this mutation changes thefirst nucleotide in the eighteenth intron of the gene,causing exon 18 to be spliced to exon 20, thusskipping exon 19)j. deletion of the poly-A addition sitek. G-to-A substitution in the 5′ UTRl. insertion of 1000 base…
Why do frameshift mutations generally have more seriousconsequences than missense mutations?