In the formation of the initiation complex, which protein wraps around the DNA double helix forming a platform on which the remainder of the initiation complex can be assembled? TATA GTF TBP Pol II
Q: Describe the process of how the bicarbonate ion is is reabsorbed in the nephron tublule, if the Na/K…
A: bicarbonate ion Reabsorption in the nephron tublule different nephron tubule play a crucial role in…
Q: List three similarities of the green algae (fresh green scum from the water pond). 2. List two ways…
A: Algae It is a group of eukaryotic organisms. It is a very simple, non- flowering and an aquatic…
Q: The enzyme used to catalyze the initial fixation of CO2 in C4 photosynthesis is: NADP+ reductase…
A: The physiological process by which in green plants synthesize carbohydrates with the absorption of…
Q: 10. In many viral diseases illness occurs shortly after exposure to the virus. In other cases, the…
A: Viruses are obligate parasites and they are different from other microorganisms with respect to…
Q: "In the early cleavage stages, when the embryo cannot yet feed, the developmental program is driven…
A: Fertilization functions as a trigger point to initiate the program of embryonic development that…
Q: Whether the statement, "Disturbance of the balance in the activities of osteoblasts and osteoclasts…
A: Introduction:The two essential processes that keep the homeostasis of bone density in place are bone…
Q: The Acheulean Complex A. Includes tools known as handaxes. B. Is characteristic of Homo habilis. C.…
A: The Acheulean Complex is a group of complex handmade tools invented by homo erectus in East Africa.
Q: Draw what galactosemia would look like in your body WITHOUT WORDS and explain it
A: Introduction - • Galactosemia: too much galactose in the blood.- When a person consumes dairy (which…
Q: A. Kinesins OB. Ran-GTP OC. Kinetochores OD. Centrosomes
A: 1) kinesins- kinesins are motore protein which functions and transport organelles within cells. Role…
Q: Which of the following most accurately describes the process involved in protein synthesis?…
A: Introduction The decoding of an mRNA message into a polypeptide product is known as translation in…
Q: Echinoderms facts bulleted
A: Echinodermata is a phylum of invertebrates. Phylum Echinodermata consists of organisms that have…
Q: Population size (N) 500 400- 300- 200- 100- 0- -~ 3 6 7 5 Generations -0₂ B D 9 10 ...
A: Answer. 2. Rate of population growth will decrease.
Q: In insect embryonic development, the fertilized egg nucleus divides repeatedly giving rise to…
A: Embryonic development in insects The period of development of embryo starts at fertilization and at…
Q: Which type of mutation results in the most severe form of junctional Epidermolysis Bullosa
A: Epidermolysis bullosa (EB) is one of the rare type of genetic related disease resulting in the very…
Q: Sickle Cell Anemia Sickle cell anemia is a group of blood disorders that develop when a person…
A: Sickle cell anemia is a genetic disorder. It is condition when the normal red blood cells change its…
Q: explain pigs are ideal hosts for generating new strains of human influenza virus
A: According to the swine "mixing vessel idea," since pigs may contract both avian and human influenza…
Q: 24. Why is the proportion of actin within filaments in cells smaller than would be predicted by in…
A: Actin forms the thin filament in vivo and it cross links with myosin at the time of muscle…
Q: How many potential combinations of paternal and maternal homologs can be generated during meiosis.
A: Most eukaryotic species reproduce sexually, as stated in the introduction. This combines the genomes…
Q: briefly explain what TPACK model is all about and how it can be applied in life science
A: The TPACK model focuses on developing the ideal fusion of the material being taught and the manner…
Q: what
A:
Q: Some individuals with immunodeficiency have mutations in the digesting enzymes of their macrophages.…
A: Answer. MHC receptor will present antigens on the surface of the macrophages.
Q: Which of the following would provide evidence that the isolated component was a protein?
A: According to the question, the experiment was conducted on bacterial strain to detect the function…
Q: Explain how the binding of heroin to presynaptic neurones raises the probability of action…
A: Heroin is the opiate that is mostly used. Morphine is converted into heroin. Opioids boost the…
Q: Capillaries are very thin, narrow blood vessels that allow for the transfer of oxygen, carbon…
A: The sickle cell mutation affects the ability of red blood cells to perform their normal function.…
Q: Briefly interpret the graph and maps attached about the evolutionary arms race among garter snakes…
A: The evolutionary arms race is the result of the co-evolution of a predator and a prey. It is a…
Q: Cell contains 1 set of unreplicated chromosomes A Process 1 A What has happened during Process 2?…
A: The diagram in the question shows the process of cell cycle. "A" represent the parent cell. "B"…
Q: explain how heart rate is controlled by the heart itself and by the ANS
A: The number of times the heart beats due to contractions of the heart per minute is referred to as…
Q: DNA gyrase decreases the number of positive supercools. What is the result of this process?
A: Thousands of different enzymes catalyze metabolic processes in cells. Enzymes are proteins that…
Q: C) Sexually transmitted infections (STIS) include any contagious disease acquired as a result of…
A: Sexual transmitted infections ( STIs) Sexual transmitted infection is a disease caused by bacteria,…
Q: 1. Which of the following statements is correct for the homeotic genes that will be activated in the…
A: a. segment polarity genes will activate ultrabithorax such that wings develop only in the forming…
Q: Explain the reason why in the absence of Delta, cells become unsynchronized and somites are not…
A: Introduction: Delta from the neighbouring cell attaches to the notch receptor during Delta-Notch…
Q: In skin cells, a gene is never transcribed. Give two ways this could occur.
A: Transcription is carried out by an enzyme known as RNA polymerase and a group of proteins known as…
Q: #7 Three mushroom-forming species are adapted to live in the desert. How are desert mushrooms…
A: Introduction : The fleshy, spore-bearing fruiting body of a fungus that normally grows above ground…
Q: A Animals have cells of various sizes and shapes. Fat cells are roughly spherical and can be quite…
A: Digestive system: The mouths, pharynx (throat), oesophagus, stomachs, intestinal tract, bowel,…
Q: Bodo and Daka hominins are ________; Dmanisi is __________. A. African; at the intersection of…
A: The term "hominin" refers to a group that includes all living humans as well as all extinct species…
Q: how many chromosomes are present in a human cell during anaphase of mitosis? A. 23 B. 92 C. 22…
A: Cell division is a phenomenon in which parent cell splits and gives rise to new cells . Number of…
Q: Please discuss the different types of pigmentation of the human skin and their meaning. 1. Your…
A: Having pigment means having color. Issues of skin pigmentation have an impact on the skin's color.
Q: A) what type of mutation is shown based on the nature of the genetic change (frameshift mutation or…
A: Mutation A change in the nucleic acid sequence of an organism's, virus's, or extrachromosomal DNA is…
Q: explain the way in which complement reaction remains localized when active products leave the…
A: The immune system's effective phagocytosis and the functioning of antibodies are both enhanced by…
Q: Hypervolemia O
A: Definition Causes Net movement of water Signs and symptoms Treatment
Q: Which of the following is the most predictable outcome of increased ge ulations? ower average…
A: A gene is a section of DNA where a function is encoded. A chromosome is a lengthy DNA strand that…
Q: The (blank) gene is constitutively active (always making protein).
A: The segment of DNA that can produce a polypeptide is called gene. It is an inherited factor that…
Q: (a) (b) Complete the table by writing the letter from the diagram which refers to each part of the…
A: The plasma membrane also called the cell membrane is the double-layer membrane that encloses inner…
Q: Please select all cellular processes that do NOT rely on RecA protein function as far as we…
A: RecA is a 38kDa recombinase protein found in prokaryotes and is essential for the maintenance,…
Q: 11. Milk contains both proteins and lipids, why does their digestion result in an increased
A: Milk contains water, lipids or fats, proteins and lactose sugar. Lactose is digested by the lactase…
Q: Is a calorie from junk food the same as a calorie from a healthy food? Explain your thinking. 2.…
A: It is important to know that the calories are a measure of energy and we should focus more on the…
Q: Determine the titre of the undiluted phage. 245 Counted plaques. We plated 100 micro Liters (1/10th)…
A: It is feasible to figure out the concentration of virus particles in a phage stock by diluting it…
Q: Explain the nature of the morphogenetic substance that gives rise to alkaline phosphatase.
A: Morphogens are proteins that regulate an organism's morphogenesis. Morphogens are essential to an…
Q: Explain how CO2 loading and O2 unloading are connected in systemic gas exchange. Make sure to…
A: Chloride shift is a process that occurs in the cardiovascular system and refers to the exchange of…
Q: Most Americans, including some health care professionals, think that parasites are a problem of the…
A: Parasites are organisms that derive nutrition from other living beings. These living beings are…
Step by step
Solved in 3 steps
- Provide the complementary strand and the RNA transcription product for the following DNA template segment:5'-AGGGGCCGTTATCGTT-3'A section of template DNA has the following sequence of nitrogenous bases: 5’-CGATTACTG-3’. Which of the following sequences would be produced as a result of transcription? Group of answer choices CGTUUTCAG CGAUUACUG GCUAAUGAC GCTAATGACGIVEN THE FOLLOWING DNA SEQUENCES (+) OF THE GENBANK: INDICATE WHICH IS THE TEMPLATE MOLECULE, WHICH IS THE mRNA AND THE POLYPEPTIDE THAT IS FORMED FROM THE SEQUENCE DNA 5' atgagtaaagga 3'
- What polypeptide would be produced from the following strand of DNA? The first pair of nucleotides (bolded) contains the start point of transcription. Label the C-terminus and N-terminus ends of the polypeptide. 3’-ATGCCTACGGGTACGCCACTACTCCC-5’ 5’-TACCCATGCCCATGCGGTGATGAGGG-3’A pre-initiation complex (PIC) is required for transcription to begin. State in which TFII protein has a catalytic function.In the DNA segment 5′-ATGAGGCATGAGACG-3′(coding strand) 3′-TACTCCGTACTCTGC-5′ (template strand) • What products would be formed from the segment’s replication? • Write the mRNA sequence that would be obtained from the segment’s transcription. • What is the amino acid sequence of the peptide produced from the mRNA?
- . Locate the -10 region hexanucleotide sequence in the following coding strand of DNA. Indicate the region of the RNA polymerase initiation site. AATTGGGATCCCTATAATGCGCCTACGTTGAGACGAGTGGACGCHow does the RNA polymerase II enzyme identify/distinguish the “start” of a gene from the junk DNA that makes up 98% of our DNA? Describe what happens during transcription initiation.Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT
- Transcribe and translate the following DNA sequence (nontemplate strand); 5GCATGCGCGGCCATGTTGATTAAGCA 3Show and label the ends of your code for each step.How would nucleotide excision repair be affected if one of the followingproteins was missing? Describe the condition of the DNAif the repair was attempted in the absence of the protein.A. UvrAB. UvrCC. UvrDD. DNA polymeraseGiven the following mRNA codons and amino acids, construct a polypeptide from this DNA strand. DNA AAT GGT CCA CCG CTG mRNA Amino Acids UUA= leucine GAC= asparginine GGU= glycine GGC= glycine CCA= proline