--ina Category 1: Cell Structure and Functionrartlu into a Prokaryotic Pizza and aCut out the sEukaryotic IReporting Category 2: Mechanisms of GeneticsInstructions: Answer the questions shown below on the following answer sheet.SATGAGGGCGAGCGGCGCCCACGTTTTAGGGTGA3'TACTCCCGCTCGCCGCGGGTGCAAAATCCCACTS1. What isthe name of||||molecule?Cellewhetheis a largecell's genthin layeThe nuclEukaryProkartain numeaninmeaniotic ceProlsimp2. What cellular process is being shown by thearrow?3. Where in the cell does this process take place?S'AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA³MRNA4. RNA should be in a 5' to3'direction. Based on this5. What cellular process is being shown by the arrow (MRNA to aminoInformation which DNA strand will beyour template strand to make theacidaMRNA?6. Where in the cell does this process take place?Amino acidsexceUse the codon chart to determine the correct amino acids.(you may abbreviate)ger7. How manyMRNA basesotmake up acodon?MRNA Codon Chart8. What is thepurpose of acodon?AlanineGUTyrosineASlopGUValineU CysteineUG AStopTryptophanful defirG.ArginineA GACotic cells:Leucinechain of a1: part ofSerineAsite of pr(RNALysineUGProlineAsparagineSerineAsparticacidHistidineThreonine

DNA is a genetic material which carries some hereditary information in form of genes which is…

Instructions: Answer the questions shown below on the following answer sheet. SATGAGGGCGAGCGGCGCCCACGTTTTAGGGTGA' 1. What is the name of this molecule? 3TACTCCCGCTCGCCGCGGGTGCAAAATĊCCACT³ 2. What cellular process is being shown by the arow? 3. Where in the cell does this process take place? S'AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA MRNA 4. RNA should be in as to 3'rection. Rased on this Information which DNA strand will be your template strand to make the mANA 5. What ceflular process is being shown by the arrow (mRNA to amino acids?) Where in the cell does this process take place? Amino acids Use the codon chart to detemmine the correct amino acids. (you may abbreviate) How many RNA bases make up a odon? MRNA Codon Chart What is the pose of a on? UCAO Alanine GU Tyrosine C Stop GU AC Valine Cysteine Stop G A G Tryptophan Arginine AG U č Leucine Serine C Lysine UG ACU GACU Proline Asparagine Glycine Aspartic acid Leucine Serine 110345 Threonine Histidine Methionine Isoleucine

Instructions: Answer the questions shown below on the following answer sheet. SATGAGGGCGAGCGGCGCCCACGTTTTAGGGTGA' 1. What is the name of this molecule? 3TACTCCCGCTCGCCGCGGGTGCAAAATĊCCACT³ 2. What cellular process is being shown by the arow? 3. Where in the cell does this process take place? S'AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA MRNA 4. RNA should be in as to 3'rection. Rased on this Information which DNA strand will be your template strand to make the mANA 5. What ceflular process is being shown by the arrow (mRNA to amino acids?) Where in the cell does this process take place? Amino acids Use the codon chart to detemmine the correct amino acids. (you may abbreviate) How many RNA bases make up a odon? MRNA Codon Chart What is the pose of a on? UCAO Alanine GU Tyrosine C Stop GU AC Valine Cysteine Stop G A G Tryptophan Arginine AG U č Leucine Serine C Lysine UG ACU GACU Proline Asparagine Glycine Aspartic acid Leucine Serine 110345 Threonine Histidine Methionine Isoleucine

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter13: Diversity Of Microbes, Fungi, And Protists

Section: Chapter Questions

Problem 1ACQ: Figure 13.6 Which of the following statements is true? a. Gram-positive bacteria have a single cell...

See similar textbooks

Similar questions

1. It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand:GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT
Match the following terms with their descriptions:Heredity (a) Threadlike molecule of DNA,Chromosome typically circular in prokaryotesPhenotype (b) Permanent alteration in DNAGene (c) Involves the transmission ofAlleles information from an organismMutation to its progenyGenotype (d) Refers to the genetic informa- tion contained in the DNA of an organism (what it actually is) (e) The specific characteristics displayed by the organism (what it appears to be) (f) Linear sequence of DNA that carries coded instructions for…
10. _E.coli phage T4 DNA is terminally redundant and ____________________.A. linearly permutedB. circularly permutedC. single-strandedD. blunt endedE. none of the above 11. ___________ allows cells to maintain the chromosome number.A. MeiosisB. MitosisC. Binary fusionD. BuddingE. None of the above 12. ___ is the repair of UV-damaged DNA by a light-dependent enzymatic reaction.A. PhotoreactivationB. Sensory deprivationC. PhotoinductionD. PhotosynthesisE. none of the above
You are given the sequence below. Which one would be an appropriate SaCas9 (PAM = ‘NNGRRT’) protospacer? (Multiple possible) 5’-CATGATCTGGGTCATCTTCTCGCGGTTGGCCTTGGGATTGAGGGGGGCCTCGGTGAGCAGGGTGGGG-3’ 5’-AGGCCAACCGCGAGAAGATG-3’ 5’-CATCTTCTCGCGGTTGGCCT-3’ 5’-GAGGGGGGCCTCGGTGAGCA-3’ 5’-CATGATCTGGGTCATCTTCT-3’ 5’-TTGAGGGGGGCCTCGGTGAG-3’
The cell above is a lung cell of a salamander. In which stage of mitosis is it? What are the structures visible in green and blue fluorescence?
The chromosome number ______. a. refers to a particular chromosome in a cell b. is a characteristic feature of a species c. is the number of autosomes in cells of a given type d. is the same in all species
What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
Unlike eukaryotic cells, prokaryotic cells ________. a. have no plasma membrane b. have RNA but not DNA c. have no nucleus d. a and c
Look at the two yeast colonies in Figure Q4–3. Eachof these colonies contains about 100,000 cells descendedfrom a single yeast cell, originally somewhere in the mid-dle of the clump. A white colony arises when the Ade2 geneis expressed from its normal chromosomal location. Whenthe Ade2 gene is moved to a location near a telomere, itis packed into heterochromatin and inactivated in mostcells, giving rise to colonies that are mostly red. In theselargely red colonies, white sectors fan out from the middleof the colony. In both the red and white sectors, the Ade2 gene is still located near telomeres. Explain why white sec-tors have formed near the rim of the red colony. Based onthe patterns observed, what can you conclude about thepropagation of the transcriptional state of the Ade2 genefrom mother to daughter cells in this experiment?
The terms conjugation, transduction, and transformation are usedto describe three different natural forms of genetic transferbetween bacterial cells. Briefly discuss the similarities and differencesamong these processes?
An ade+ arg+ cys+ his+ leu+ pro+ bacterial strain is knownto be lysogenic for a newly discovered phage, but the siteof the prophage is not known. The bacterial map isleucysarghisadeproThe lysogenic strain is used as a source of the phage, andthe phages are added to a bacterial strain of genotypeade- arg- cys- his- leu- pro-. After a short incubation,samples of these bacteria are plated on six differentmedia, with the supplementations indicated in thefollowing table. The table also shows whether colonieswere observed on the various media.PresenceMedium Ade Arg Cys His Leu Pro of colonies1 - + + + + + N2 + - + + + + N3 + + - + + + C4 + + + - + + N5 + + + + - + C6 + + + + + - NNutrient supplementation in medium(In this table, a plus sign indicates the presence of anutrient supplement, a minus sign indicates that asupplement is not present, N indicates no colonies, and Cindicates colonies present.)a. What genetic process is at work here?b. What is the approximate locus of the prophage?
1. _____________ frequencies are used to obtain a genetic map.A. TransductionB. ReconstitutionC. TransformationD. RecommendationE. Recombination 2. A __________ shows an individual cell's metaphase chromosomes arranged in pairs and sorted by size.A. phenotypeB. genotype C. karyotypeD. fingerprintE. none of the above 3. During conjugation, E.coli chromosomal transfer begins at ________.A. oriVB. oriCC. oriTD. oriAE. none of the above