Instructions: Put the following terms into a word map to explain how they are interrelated for DNA structure and DNA replication. Adenine Cytosine Deoxyribose DNA DNA helicase DNA polymerase Double helix Lagging strand Leading strand Ligase Guanine Nucleotide Okazaki fragment Phosphate Phosphodiester bond Primase Guidelines for building a word map: Primer Replication fork Semidiscontinuous Single-stranded binding proteins Telomere Template Thymine Topoisomerase II Each word in the list will be a node on the map ● Every word needs be connected to at least one other ord by a line All connecting lines need a few words to describe the relationship between the words that are being connected To figure out the direction of arrows, think of each relationship between words as sentences. These examples come from the sample Mitosis/Meiosis word map below: O "Mitosis is a type of cell division" O "Mitosis produces cells that are diploid" O "Sister chromatids are separated in meiosis"

Instructions: Put the following terms into a word map to explain how they are interrelated for DNA structure and DNA replication. Adenine Cytosine Deoxyribose DNA DNA helicase DNA polymerase Double helix Lagging strand Leading strand Ligase Guanine Nucleotide Okazaki fragment Phosphate Phosphodiester bond Primase Guidelines for building a word map: Primer Replication fork Semidiscontinuous Single-stranded binding proteins Telomere Template Thymine Topoisomerase II Each word in the list will be a node on the map ● Every word needs be connected to at least one other ord by a line All connecting lines need a few words to describe the relationship between the words that are being connected To figure out the direction of arrows, think of each relationship between words as sentences. These examples come from the sample Mitosis/Meiosis word map below: O "Mitosis is a type of cell division" O "Mitosis produces cells that are diploid" O "Sister chromatids are separated in meiosis"

Name: Please see instructions and exmaple. It should only be one big map. In
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Please see instructions and exmaple. It should only be one big map. Instructions:Put the following terms into a word map to explain how they are interrelated forDNA structure and DNA replication.●AdenineCytosineDeoxyribose●DNADNA helicaseDNA polymera

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

Need to understand how to do this: create the complementary strand of DNA to the DNA strand provided below: 1. ATAGGTCACCGTAA 2. TCCAGA
DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Give the discussion of the entire procedure
INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: If 3’ ATTG 5’ is transcribed, the complementary strands is 5’ UAAC 3’ STAMENT 2: Guanine and Cytosine are purine bases ANSWER: STAMENT 1: The general term for the enzyme that connects nucleotide triphosphates in DNA is DNA transferase STAMENT 2: The enzyme that unwinds the double stranded DNA is topoisomerase ANSWER: STAMENT 1: The name of the compound formed when uracil is bonded to ribose is uradine STAMENT 2: The piece of nucleic acid that is complementary to the DNA template and serves as a starting point of replication is called RNA promoter ANSWER:
Which of the following DNA double helices would be more difficultto separate into single-stranded molecules by treatment withheat, which breaks hydrogen bonds?A. GGCGTACCAGCGCATCCGCATGGTCGCGTAB. ATACGATTTACGAGATATGCTAAATGCTCTExplain your choice.
DNA Replication Explanation Must Include (no essay) Leading strand with 5' and 3' Lagging strand with 3' and 5' - Okazaki fragments Bases (following the base pairing rule) Primase -Primer helicase Polymerase Ligase Parent Strands Daughter Strands New DNAs - semiconservative
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
Picture is only attached as reference. How does the model attached show DNA Replication?What is the importance of DNA Replication?What will happen if there will be an error during the DNA Replication Process?
INSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a. complimentary DNA strand 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C b. mRNA 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C c. protein synthesized 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C
Correct order ib which the following enzynes would operate to fix a damaged nucleotide in a human gene. a) nuclease, DNA polymerase, RNA primase b) helicase, DNA polymerase, DNA ligase c) DNA ligase, nuclease, helicase d) nuclease, DNA polymerase, DNA ligase
DNA Repication Explanation (no ESSAY) Must include STEP BY STEP Leading strand with 5' and 3' Lagging strand with 3' and 5' - Okazaki fragments Bases (following the base pairing rule) Primase -Primer helicase Polymerase Ligase Parent Strands Daughter Strands New DNAs - semiconservative
Human Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second in human cells and origins of replication occur every 300 kbp. Assume also that human DNA polymerases are highly processive and only two molecules of DNA polymerase arc needed per replication fork. How long would it take to replicate the entire diploid human genome? How many molecules of DNA polymerase does each cell need to carry out this task?
During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicase