Label the figure to assess your knowledge of DNA replication. Drag the appropriate labels to their respective targets Reset] Help Okazaki fragment DNA polymera ase DNA polymerase Nucleotide Leading strand Replication fork Stabilizing proteins Ligase Primase Helicase Lagging strand RNA primer IIIN
Q: rovide a detailed description and hand-drawn figure for each of the following. (1) DNA…
A: DNA REPLICATION:- It is the process of making two identical daughter copies of DNA from the one…
Q: How do you do this? can you explain and show me? Replication Given Original DNA strand: ATCCTAGCC.…
A: Replication is the process by which a double stranded DNA molecule is copied to produce to identical…
Q: 2. Shown below is a long template strand of DNA where lagging strand DNA synthesis is occurring. The…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: 1. Which sequence has a purine base at the 3' end? A) TCTAG B) AUCCT C) GUGCCU D) CCTTC 2. Select a…
A: Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are the nucleic acids which are…
Q: E) SEMI-DISCONTINUOUS REPLICATION Anti parallel strands replicated simultaneously OLeading strand…
A: Replication is the process by which a double-stranded DNA molecule is copied to produce two…
Q: Using the picture below, match each letter (A-E) to 5' or 3' DNA polymerase molecule Parental DNA…
A: As the options are not visible, we are answering the question based on the general principle of DNA…
Q: Match the statement to the corresponding agent/key player in DNA replication. Some items require…
A: DNA replication is the biological process where a double-stranded DNA molecule is copied or…
Q: Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT
A: In DNA replication, the rule of complementarity is as follows- 1. Adenine (A) and Thymine (T) are…
Q: Letter 'd' corresponds to 5' 5' 3' origin of replication. primer. O replication fork. O Okazaki…
A: The Central Dogma theory states that DNA makes RNA and RNA makes proteins. DNA replication is the…
Q: Shown below is a double stranded DNA molecule.Replicate this DNA and show the products formed from…
A: DNA REPLICATION :- It is the process by which DNA makes a copy of itself during cell division. The…
Q: From among only the following, the THIRD step in DNA replication is Primase produces an RNA primer…
A: Primase creates an RNA primer, which is a brief stretch of complementary nucleic acid that serves as…
Q: Single strand as a template plus 3' end to start DNA synthesis но- Polymerase works, DNA synthesis…
A: Addition of bases to the primer occurs as DNA replication proceeds :-
Q: Determine the complementary strand of DNA that forms on this template DNA fragment during…
A: The complementary strand of the DNA fragment during the replication : 3' CCAAAGAAGTTCTCT 5'
Q: iginal mplate) HA denine Thymine Cytosine Guanine nzymes and structures to label: hromosome…
A: A chromosome is a long DNA molecule with part or all of the genetic material of an organism.Most…
Q: 12.Proof reading in eukaryotic DNA material 13.Removal of eukaryotic primer 14.Adds more…
A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since…
Q: Which of the following is Not correct about Okazaki fragments? O they are synthesized by addition of…
A: option 2 is correct because there are two strands in DNA replication.one is leading strand and the…
Q: What enzyme synthesizes small primers for DNA polymerase to bind to so it can initiate DNA…
A: DNA replication is the first process in the central dogma of life. It involves the synthesis of new…
Q: Label! Label! Practice: DNA Structure and Replication 1. Label cach part of the model to the right.…
A: DNA is a complex biomolecule that composed of Deoxyribose suger, phosphoric acid and nitrogen base.…
Q: Match each protein involved in DNA replication with its correct function in E. coli. An answer can…
A: DNA replication is the molecular process involving different enzymes in different steps of…
Q: Choose all of the true statements about DNA replication in cells. Hint: 2 statements are true.…
A: DNA replication: DNA replication is the cycle by which a double-stranded DNA atom is duplicated to…
Q: Which of the following is Not correct about Okazaki fragments? they are synthesized by addition of…
A: Okazaki fragments are named on its discoverers name Tsuneko Okazaki a Japanese scientist. Okazaki…
Q: The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat…
A: WT replication without slippage:
Q: i) Assume that the following polynucleotide is part of a longer DNA molecule. Write out the product…
A: DNA It is defined as a genetic material which has all the stored genetic information of an…
Q: Drag an arrow in the appropriate direction of travel for DNA Helicase Replication fork Trihoshate…
A: The course of replication is done with the assistance of various enzymes, for example, helicase, DNA…
Q: Replication. Complete the table by writing the sequence of the complementary strand. Strand 1 3’…
A: The DNA is a double helical and phosphate backbone along with nitrogenous bases that are…
Q: You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are…
A: Replication is the process by which the DNA generates a copy of itself. Transcription is the process…
Q: Holds the processive enzyme in prokaryotes Start of replication in prokaryotes Holds the processive…
A: 1. SSBP helicase holds processive enzymes in prokaryotes 2. Replication starts at ORI C ORIGIN OF…
Q: DNA Structure and Replication 2 3 4 10 11 12 13 14 15 16 17 19 Across DOwn 1 Enzyme that "glues"…
A:
Q: Choices: Origin of replication Bubble SSBP RPA Sliding Clamp PCNA DNA Pol III Pol ε Pol δ DNA Pol I…
A: Replication is the process of making a copy of the DNA. It is the first stage of the central dogma.…
Q: Match the letters with the enzyymes and macromolecules invoived DNA replication: A B INCOMING…
A: There are number of processes necessary for the continuation of generation , growth and…
Q: Sort the phrases into the appropriate bins depending on which protein they describe. 1) Binds at the…
A: Deoxyribonucleic acid (DNA) replication process involves copying DNA from the existing DNA. In DNA…
Q: Match the enzymes given below with their correct placement on the diagram. Record your answers onto…
A: The process by which a DNA molecule is copied to two identical DNA molecules is known as DNA…
Q: I'm struggling with understanding DNA replication, more specifically transcription and translation…
A: DNA replication is asymmetrical because one new strand is synthesized continuously, called as the…
Q: Select the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer…
A: DNA is the genetic material of almost all the organisms, except few viruses and is present in the…
Q: A friend asks for help understanding replication for the next biology test. (S)he draws a…
A: Replication of DNA takes place in 5' to 3' end direction. Template strand = 3' end to 5' end , make…
Q: Label the following diagram using the words from the word box below. You can write your answers in…
A: As per our company guideline we are supposed to answer only first question or first 3 subparts of…
Q: Polymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication…
A: The compounds known as nucleotides are made up of a nitrogenous base, a phosphate group, and a sugar…
Q: Match the statement to the corresponding agent/key player in DNA replication. Some items require…
A: The transmission of chromosomal DNA from one generation to the next generation is done with the help…
Q: 1 Two DNA double helices are formed, showing semi- conservative replication (show what this means).…
A: Deoxyribonucleotide (DNA) is a molecule that carries genetic material in all living organisms. It…
Q: Click on your screen over the DNA polymerase III enzyme depicted on the lagging strand. Replication…
A: Introduction : DNA replication is the process through which daughter DNA is formed from parental…
Q: Write the DNA strand that is complementary to the strand shown below. Be sure to mark the ends of…
A: DNA is a polymer of nucleotides and a double-stranded molecule.
Q: Give the DNA compliment to the following DNA strand. ATG UAC b. TAC GTG OMG
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: The image below shows the replication bubble of a piece of DNA in the process of replication.…
A: DNA is a double stranded structure in which one strand is wound on another. The DNA is a…
Q: Use the following information to answer the next four questions. Nucleic Acid…
A: Nucleic acids are the polymers of the nucleotides.
Q: Match the enzyme or protein to the replication process. Record your answers onto the Google Fom. a.…
A: 58 ) unwinds helix and breaks hydrogen bonds to make a replication fork : helicase 59 )…
Q: Please match each protein with its role in DNA replication binds to the origin of replication 1.…
A: DNA replication is the biological process of copying the contents of DNA ie, forming two identical…
Q: A biochemist isolates, purifies and combines ina test tube a variety of molecules needed for DNA…
A: According to the central dogma of molecular biology, DNA is converted to RNA (transcription) and RNA…
Q: A replication fork is shown below. The primary enzyme that catalyzes replication is DNA polymerase…
A: The replication fork * is a region where a cell's DNA * double helix has been unwound and separated…
![Label the figure to assess your knowledge of DNA replication.
Drag the appropriate labels to their respective targets
Reset] Help
Okazaki
fragment
DNA polymera
ase
DNA polymerase
Nucleotide
Leading strand
Replication fork
Stabilizing
proteins
Ligase
Primase
Helicase
Lagging strand
RNA primer
IIIN](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2Ff560d343-a43d-487e-be3d-0028ebda9482%2F79d53a7b-757b-4f3b-a6a3-19289339aae5%2F92wti5.png&w=3840&q=75)
Trending now
This is a popular solution!
Step by step
Solved in 4 steps with 2 images
- During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicaseA. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…Identify the enzyme/protein involved in replication: multiple choice Addition of short RNA primers at the leading and lagging stranda) dna ligaseb. dna proteinsc. dna gyrased. single-strand binding proteinse. primasef. helicaseg. 5' - 3' polymeraseh. RNA polymerasei. other:_
- DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OHDetermine the complementary strand of DNA that forms on this template DNA fragment during replication: 5′GGTTTCTTCAAGAGA3′I'm struggling with understanding DNA replication, more specifically transcription and translation (5' and 3' opposite orrientations). Could you help to explain this? Thanks!
- ii) Assume that the following polynucleotide is part of a longer DNA molecule. Write out the product that would be obtained from its replication.3 AAGCTTTCCGcan you please only do the part " Show DNA replication using the following DNA Strand: AAT CAT GGG CCA "PLEASE HELP ME WITH THIS ONEMatch the statement to the corresponding agent/key player in DNA replication. Some items require more than one answer. Choices: Origin of replication Bubble SSBP RPA Sliding Clamp PCNA DNA Pol III Pol ε Pol δ DNA Pol I RNAse H Flap 1 DNA gyrase Pol α DNA helicase Primase Single chromosome Multiple points in chromosomes DNA ligase Not applicable Holds the processive enzyme in prokaryotes Start of replication in prokaryotes Holds the processive enzyme in eukaryotes Primosome in prokaryotes Dissociates after adding the few initial nucleotides in eukaryotes Adds more nucleotides in the lagging strand of prokaryotes Make primers for the replicative enzymes in eukaryotes Adds more nucleotides in the leading strand of prokaryotes Adds more nucleotides in the leading strand of eukaryotes Adds more nucleotides in the lagging strand of eukaryotes Start of replication in eukaryotes Removal of eukaryotic primer Breaks the H-bonds of bases Proof reading in prokaryotic…
- Complete the complementary strand: DNA replication ATTCGAGGCTAAYou are given a segment of DNA : 5’ - CATGTCAAC – 3’ What is the complimentary strand?A biochemist isolates, purifies, and combines in a test tubea variety of molecules needed for DNA replication. Whenshe adds some DNA to the mixture, replication occurs, buteach DNA molecule consists of a normal strand paired withnumerous segments of DNA a few hundred nucleotides long.What has she probably left out of the mixture?(A) DNA polymerase(B) DNA ligase(C) Okazaki fragments(D) primase