Match the enzyme or protein to the replication process. Record your answers onto the Google Fom. a. DNA polymerasel b. DNA polymerase Il c. DNA polymerase III d. primase e. DNA ligase f. helicase 9. single-strand-binding proteins h. topoisomerase Il 58. Unwinds helix and breaks hydrogen bonds to make a replication fork. 69. Removes RNA primer and replaces it with DNA nucleotides. 60. Joins together the fragments made on the lagging strand. 61. Adds a short segment of RNA to start replication. 62. Stabilizes newly unwound strands. 63. Catalyzes the addition of new nucleotides, one at a time. 64. Relieves strain of over winding created by replication fork. 65. Proofreads new nucleotide sequence for correctness.

Match the enzyme or protein to the replication process. Record your answers onto the Google Fom. a. DNA polymerasel b. DNA polymerase Il c. DNA polymerase III d. primase e. DNA ligase f. helicase 9. single-strand-binding proteins h. topoisomerase Il 58. Unwinds helix and breaks hydrogen bonds to make a replication fork. 69. Removes RNA primer and replaces it with DNA nucleotides. 60. Joins together the fragments made on the lagging strand. 61. Adds a short segment of RNA to start replication. 62. Stabilizes newly unwound strands. 63. Catalyzes the addition of new nucleotides, one at a time. 64. Relieves strain of over winding created by replication fork. 65. Proofreads new nucleotide sequence for correctness.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 2VCQ: Figure 14.14 You isolate a cell strain in which the joining of Okazaki fragments is impaired and...

See similar textbooks

Similar questions

A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…
Which of the following is/are true regarding the enzyme primase? a: primase functions during cellular DNA replication. b: without primase activity, DNA polymerase in our cell can NOT begin synthesizing new nucleotide chains. c: primase uses dNTP building blocks d: primase is a polymerase enzyme e: primase functions AFTER DNA helicase activity. Ps: This has multiple answers. thank you.
Which statement about Okazaki fragments is true? Select one: a. DNA polymerase doesn’t need a primer to build these fragments b. They act as a primer that initiates DNA replication. c. They correct errors made during earlier phases of DNA replication. d. They are necessary because DNA polymerase can only build DNA in the 5’ to 3’ direction, so for one of the strands at each fork, the DNA polymerase can only buildaway from the fork. e. They prevent the ends of chromosomes from shortening with every replication.
(a) What is the function of helicase in DNA replication?(b) What is the function of DNA polymerase?(c) What are replication forks? Compare and contrast leading and lagging strands. Answer all please
A student mixes various molecule needed for DNA replication. When he adds DNA, replication occurs, but each DNA duplex consists of a normal DNA strand paired with numerous segments of DNA a few hundred nucleotides long. What has been left out of the mixture? A. NTPs B. DNA polymerase III C. ATP D. DNA polymerase I E. DNA ligase
Match each enzyme name in the left column with the correct descriptive phrase in the right column. (a) Topoisomerase II(b) DNA ligase(c) DNA polymerase γ(d) Reverse transcriptase(e) DNA polymerase I(f) DNA polymerase III i. Catalyzes most nucleotide incorporations in bacterial DNA replicationii. Cleaves RNA in a DNA–RNA hybrid moleculeiii. Uses a tRNA primer in synthesis of retroviral DNAiv. Acts through an adenylylated DNA intermediatev. Catalyzes formation of a double-strand DNA breakvi. Catalyzes mitochondrial DNA replication
Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication? a. Both eukaryotic and prokaryotic DNA polymerases build off RNA primers made by primase. b. Eukaryotic DNA replication requires multiple replication forks, while prokaryotic replication uses a single origin to rapidly replicate the entire genome. c. DNA replication always occurs in the nucleus. d. Eukaryotic DNA replication involves more polymerases than prokaryotic replication.
Which statement below best describes what these data might have demonstrated to Kornberg about the process of replication? CHOOSE ONE and explain the rationale behind your answer in a minimum of four sentences. A. Products of replication are DNA polymers. B. DNA Pol I-mediated replication is a high-fidelity (i.e., no mistakes) process C. DNA Pol III-mediated replication gives rise to two daughter strands, one which is made of only the original templates, and one of which is only newly synthesized polymer. D. In DNA, all 4 classes of nitrogenous bases are more or less equally represented E. A pairs with T and C pairs with G
Place the following steps of DNA replication and repair in the correct order by numbering them from 1 to 5. a. A template strand begins to be replicated. b. If the incorrect base is not identiﬁed and replaced, it remains as a point mutation in the DNA. c. DNA polymerase identiﬁes and replaces most incorrect bases with the correct base, complementary to the base on the template strand. d. An incorrect base is added to the growing strand of DNA. e. Proteins identify and replace any incorrect bases missed by DNA polymerase.
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
Please help me to answer the following: 1. Explain how the synthesis of a DNA daughter strand growing toward a replication fork differs from the synthesis of a daughter strand growing away from a replication fork. 2. The base sequence ACGTCT represents a portion of a single strand of DNA. Please draw the complete double stranded molecule for this portion of the strand and use the representation to illustrate the replication of the DNA strand.Please clearly identify the nucleotide bases involved, the new strands formed, and the daughter DNA molecules. 3. Please explain the origin of Okazaki fragments. Thank you very muxh for your help.
Sketch a LARGE labeled figure showing one replication fork and the synthesis of one leading strand and two lagging strands of DNA in the replication bubble. Label the 5’ and 3’ ends of all DNA strands shown in your figure. Also label any DNA polymerases, DNA helicases, primases and primers. (For this question you may assume that lagging strands have not been joined.)