Macmillan LearningLabel the structural features of the yeast phenylalanine tRNA.Answer Bankregion that carries the amino acidat its endExtra arm5' endregion that contains the basesribothymidine and pseudouridineregion that contains thebase dihydrouridineregion that contains the anticodon,which base pairs with the mRNA

A tRNA molecule has distinct features and helps in the synthesis of protein from mRNA. Hence it…

Answered: Label the structural features of the…

Science

Biology

Label the structural features of the yeast phenylalanine tRNA.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 16TYU

See similar textbooks

Related questions

Q: Which of the following occurs during synaptic transmission? Select ALL that apply A) vesicles…

A: Introduction : A synapse is the point at which two neurons come together, or between a neuron and a…

Q: Predation is an interaction between two species best described how? One species benefits from the…

A: Predation is the type of interaction in which an organism (predator) kills and eats the other…

Q: In a certain population of frogs, 120 are green, 60 are brownish green, and 20 are brown. The allele…

Q: This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top…

A: Transcription is the process of the formation of RNA from DNA. DNA contains nucleotides with…

Q: What is the most accurate way to introduce mutations to particular regions in the genome? Using…

A: An modification to the genome's nucleotide sequence of an organism, virus, extrachromosomal DNA, or…

Q: The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using…

A: Introduction Gene expression is the process through which a gene's information is utilised in the…

Q: Which of the following IS NOT a form of cell-to-cell communication? Release of a steroid hormone by…

A: A step-by-step process, cellular communication involves the production of an extrinsic signal,…

Q: In paragraph how can a community sustain environment?

A: Environmental sustainability is connected with the careful or attentive use of the resources which…

Q: Acetylcholine (ACh) is the primary neurotransmitter responsible for muscle contraction. The binding…

A: Acetylcholine is a neurotransmitter that is found in both the central and peripheral nervous…

Q: A pure culture of an unknown bacterium was streaked onto plates of a variety of media. You notice…

A: A culture media for microbes is a mix of substances that can promote and sustain the growth of…

Q: In the following study, which are the experimental result and control variables? Number of spiders…

A: Introduction : In scientific experiments, a control variable is an experimental component that…

Q: What are the units of absorbed dose? What are the units of Biologically Equivalent Dose?

A: Ionization occurs when radiation strikes and knocks electrons off an atom, resulting in charged…

Q: please make a venn diagram about the characteristics of cats and dogs. PLEASE MAKE IT BROAD

A: Venn Diagram - A type of diagram that uses overlapping circles to represent the logical relation…

Q: Which of the following is an objective for the following study: Male birds are usually more colorful…

A: Males are often more colourful than females in the animal world because of sexual selection. This…

Q: Question: To cause overexpression of the genes it controls, would MECP2 protein have to remove…

A: The MECP2 gene codes for the production of a protein known as MeCP2. This protein regulates gene…

Q: 1. What are the different types of chromosomes? Draw and discuss each. 2. Discuss the following…

A: A biological process called the sex determination mechanism controls how an organism develops its…

Q: Which of the following elements is necessary for an epigenetic effect to take place? Inheritance of…

A: What is the epigenetic effect? Epigenetics deals with the study of phenotypes that environment can…

Q: how ultrafiltration works in the capillaries to move fluid between the blood and the surrounding…

A: ultrafiltration occurs at barrier between the blood and the filtrate in bowman's capsule in kidneys.…

Q: 4. Select the location where each of the following starts its function in protein synthesis. a. mRNA…

A: The mRNA or messenger RNA carries information from DNA to form protiens. Ribosomes are the…

Q: A certain autosomal recessive trait occurs in a population with a frequency of 1 in 4900. Assuming…

A: According to Hardy-Weinberg Principle, there will be a constant genetic variation in a population…

Q: 1. What are the possible explanations for why the hominid lineage may have favoured bipedal…

A: 1. The bipedal movement might have been a coping mechanism for surviving in an environment with…

Q: Is eating of dog meat good or bad? Essay

A: Food is a material that is mostly made up of nutrients such as protein, carbohydrates, and fat. It…

Q: Which of the following describes the most direct source of energy for anabolic reactions in living…

A: The metabolic reactions are the chemical reactions that occur in the cell that helps to provide…

Q: Unripe fruits are hard and tart. Ripening is a process that sweetens and softens the fruit to make…

A: A positive feedback loop accelerates ripening when ethylene is present because it encourages the…

Q: An evolutionarily stable strategy (ESS) is a Group of answer choices strategy that, if adopted by…

A: Introduction Evolutionarily stable strategy (ESS):- A behavior that all animals within the…

Q: The energy for the production of ATP comes from the breakdown of a glucose molecule via many…

A: Oxidative Phosphorylation is the process of formation of ATP and it is the final step of cellular…

Q: Figure attached, you don't need any of the textbook words to figure out the answer so don't worry…

A: Both in the presence and lack of oxygen, yeast may survive. Cells normally grow smaller under…

Q: 1- Reproductive isolation could happen in bird species if a) The birds have different singing sounds…

A: Reproductive isolation is the type of isolation that occurs when a population splits into two groups…

Q: For this plant with binomial name Ixora coccinea L., What is the reference to the original…

A: Ixora coccinea is a dense, multi-branched evergreen shrub that typically grows to a height of 4-6…

Q: LO73 Determine which nucleotides are methylated based on a sequence that has been treated with…

A: Introduction : Bisulfite sequencing is the process of treating DNA with bisulfite before performing…

Q: Describe one other indirect method of population sampling and outline its advantages and drawbacks:

A: There are a few important points : A population is generally a group of individuals of a particular…

Q: How do epigenetic marks compare in monozygotic twins? They stay the same throughout their lives…

A: Zygote is formed by fusion of male and female gametes. This process of fusion of gametes is…

Q: In a dihybrid test cross, the following results were obtained: A‑B‑, 121; A‑bb, 107; aaB-, 115; and…

A: A dihybrid cross is a type of cross in which two traits are involved . Each trait is illustrated in…

Q: Researchers have identified an enzyme that can catalyze two different chemical reactions. Which of…

A: Catalytic activity is defined as the ability of a substance to cause or accelerate a chemical…

Q: Endothermic animals can maintain consistent temperature conditions by generating, main- taining, and…

A: Incorrect options and why: A. Chloroplasts are only found in plants and are used for the production…

Q: 1. Complete the table

A: Rabies Poliovirus Hepatitis A Genome type Negative sense, non-segmented, single-stranded RNA…

Q: 13. In guinea pigs, the allele for short hair is dominant over long hair. Two short haired guinea…

A: The type of variant present at a specific locus (i.e., region) in the genome is scored by what is…

Q: In a population of 300 humans, the following blood type frequencies for the MN blood group are…

A: Blood group of an individual is determined by presence/absence of antigen on RBC 's surface and…

Q: TRUE OR FALSE Depolarization of the rod cell membrane causes increased neurotransmitter release.

A: Rod cells release more of their neurotransmitter when they are depolarized. This happens because…

Q: Do you believe stress is harmful to your health or part of life? Explain why or why not. Select 2…

A: The answer is YES. Stress symptoms can affect our body, our thoughts and feelings, and our behaviour…

Q: As DNA methylation increases, mRNA levels... Oincrease Odecrease

A: DNA methylation is a process in which the methyl groups are added to the DNA.

Q: Explain the phenomena of the loop of Henle.

A: Loop Of Henle long U-shaped portion of the tubule that conducts urine within each nephron of the…

Q: is located dorsal Which insect organ to the alimentary canal?

A: In case of insects, haemolymph is dynamic and not static, which means it is on either side of the…

Q: Explain the technologies and methods used for food production by modern society.

A: Since the inception of farming nothing much had changed before the Green Revolution. It was the…

Q: Which of the following could be identified as epigenetic effects?

A: This question is based on epigenetic effect.

Q: Which of the following variables would be appropriate as test variable if we want to test the…

A: In a population, directional selection happens when members with traits on one side of the mean live…

Q: find one primary research article about nurse plants, then do the following questions below: 1. That…

A: Nurse plant theory & its application in ecological restoration in the lower subtropics of China…

Q: A married couple makes an appointment to speak with you. Both have a genetic disorder, but they…

A: Genetics is a study of heredity and genes of how certain characteristics or qualities are passed…

Concept explainers

Cancer Therapy

Question

Macmillan Learning
Label the structural features of the yeast phenylalanine tRNA.
Answer Bank
region that carries the amino acid
at its end
Extra arm
5' end
region that contains the bases
ribothymidine and pseudouridine
region that contains the
base dihydrouridine
region that contains the anticodon,
which base pairs with the mRNA

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping. How many codons are represented in this oligonucleotide? If the second G were changed to a C, what would be the resulting amino acid?
Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
Locate a gene expression data set on Gene Expression Omnibus using "expression by hybridization" involving Rabies virus or related virus Use GEO2R to perform pairwise group analysis Explore and identify the most regulated genes: gene/protein functions of Rabies virusand Define the significance of these genes/proteins in the disease process.
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Are there homologues for the identified gene in other systems? Identify one homologue in a invertebrate system (if there is none, provide a vertebrate homologue). What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease etc.) of the protein(s) encoded by the gene.
Refer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’a. What is the mRNA transcript of the anticoding strand of the DNA model?
Help pls !! You are looking at a region of the genome that codes for a gene involved in enamel syntheiss. You do not have a transcripome (RNA sequence). Outline a protocol for deducing the ORF and the protein sequence.
Name and describe three ways in which gene expressioncan be influenced after mRNA is processed and leaves thenucleus.
Microb an mRNA molecule has the sequence 5'UCA GAA AUG CAC3. Which of the following best describes the tRNA that binds to the third/3rd codon of this mRNA? has anticodon AUG and the amino acid tyrosine It can have any anticodon and any amino acid Has the anticodon UAC and the amino acid methionine Has the anticodon CUU and the amino acid glutamic acid must have the anticodon TAC Has anticodon UUC and the amino acid lysine
In the absence of cladosporin, explain the initiation steps in the synthesis of lysyl-tRNA synthetase enzyme or protein in the bacterial cell, with the involvement of all initiation factors, each site in the ribosome, any important conserved sequence, subunits of ribosomes, initiation codon, charged tRNA containing what amino acid, whether it requires ATP or GTP
Yes or no only. rna seq can provide sequence and expression data do riboprobes synthesize bu in vitro transcription? does rna causes mutations and lose of function of specific genes?
Q11. Ribosomes are “ribonucleoprotein particles” in that they are composed mostly of rRNA with some associated ribosomal proteins. How are the genes coding for ribosomal RNAs the same as the genes coding for ribosomal proteins? They both have a transcriptional start site. They both have similar open reading frames to facilitate binding. They both have a transcriptional terminator. They both suffer frameshift mutations with the insertion of 2 nucleotides. A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1, 2, 3 and 4 are correct
A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.