Match the process to the related enzyme/structure in Bacteria. translation [ Choose ] [Choose ] DNA replication helicase ribosome transcription DNA polymerase ligase reverse transcriptase RNA polymerase

Q: The formation of mRNA from DNA is called     translation.     transcription.…

A: Question - The formation of mRNA from DNA is called A.)   translation. B.)…

Q: AC CAG CCC AAG ATT ____________ Transcription: Translation:

A: The flow of genetic information in a biological system is explained by central dogma and it involves…

Q: --short fragment of DNA produced during replication of the lagging strand of DNA. * DNA polymerase…

A: DNA replication is the process by which new DNA is synthesized from old DNA template. DNA…

Q: DNA replication begins at and ends at O start codon; stop codon O AUG; UAG Promoter; operator…

A: The expression of the genetic material occurs generally through the production of proteins,  This…

Q: 1. For cach of the items below, give a brief description (indicate function for enzymes) and…

A: All the above-mentioned enzymes are part of the central dogma of the cell. It consists of three…

Q: Statement Replication Transcription The new strand is made 5' to 3'. The new strand is made 3' to…

A:

Q: Transcription copies a _____ to a complementary _____ molecule. a. chromosome; DNA c. gene; RNA b.…

A: The gene is a basic physical and functional unit of heredity. Genes are made up of DNA.The gene is a…

Q: for an in vitro translation reaction. Which one would you leave out? Cell sap containing ribosomes O…

A: In vitro translation is a technique that in which a given mRNA is translated (outide the cell using…

Q: Fill in the blanks with all the letters of the words below that apply.

A: Replication of DNA is a semi-conservative process of duplicating a DNA strand. It depends on the…

Q: REPLICATION TRANSCRIPTION TRANSLATION Molecule or enzyme a) DNA Polymerase a) Ribosomes b) RNA…

A: Replication- DNA replication requires other enzymes in addition to DNA polymerase, including DNA…

Q: Which is more stable in a cell—DNA or RNA?

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…

Q: /hich of the following statemer ue about DNA polymerase: DNA polymerase can synthesiz- MRNA in the…

A: DNA polymerase (DNAP) is an enzyme that makes new copies of DNA in the form of nucleic acid…

Q: Fill in the blanks in the table below regarding the similarities and differences between two…

A: The replication of DNA involves opening up a double-stranded DNA molecule and creating a…

Q: Which of the following are involved in transcription? O RNA polymerase DNA amino acids TRNA acetyl…

A: In translation mRNA, tRNA, rRNA, Amino acids, ribosome, acetyl transferase are required.

Q: Translate this DNA sequence using Genetic Code 5' - ATG GGG cCC GTC CAT CCG TAC GCC GGA ATT ATA - 3'…

A: DNA is transcribed into mRNA through the process of transcription. mRNA is then translated into…

Q: Consider prokaryotes, choose the CORRECT enzyme/keyword for the following function/role: This…

A: In prokaryotic DNA replication , the  DNA copies it DNA and transfer the copy of DNA into daughter…

Q: 9The table opposite shows the triplet codes for the 20 amino acids involved in protein synther A…

A: Codons are three DNA sequence triplets that code for specific amino acids and there are a total of…

Q: Silent Mutations in DNA – Notice one nucleotide pair differs from the normal sequence given in…

A: In silent mutations, a nucleotide change can contribute to no change in the phenotype, i.e., the…

Q: Process 2 Methionine Lysine Phenylalanine Glycine Process 1 Process 2 Translation- nucleus…

A: Transcription is the process in which the information present on the DNA is transferred on to a…

Q: The following image shows how DNA can be damaged by UV light. In this reaction, UV light promotes…

A: Mutation: It is a heritable change in the genetic material of an organisms that give rise to…

Q: Why is the position of the first AUG after the ribosome-binding site critical?

A: Introduction  The process of transcribing the mRNA into protein is called Translation. There are 3…

Q: Shown below is a DNA coding strand: 5' T-A-C-T-T-C-C-C-G-A-T-C-A-T-T 3' Using the genetic code…

A: The genes in DNA encode protein molecules, which serve as the cell's "workhorses," performing all…

Q: copy of a molecule of DNA. In this process, the joining of nucleotides to extend a new strand of DNA…

A: DNA replication is a process in which DNA makes its daughter stand by making a copy of the original…

Q: Part A Which of the following processes is represented in the figure below? 3' AAG UGA RF1 RF2 O…

A: Thank you for the question  Answer :- The given picture shows translation termination Explanation :-…

Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in…

A: Mutation: - Random process - Non-directional - Most of the mutations are harmful - Most of the…

Q: Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then…

A: Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then…

Q: Only silenced DNA is wrapped around nucleosomes, active DNA is loose in the nucleus.

A: DNA silencing is the regulation of gene expression in a cell to prevent the expression of a certain…

Q: Which process is illustrated in the diagram below? NNNNNNNNNNI Oa replication Ob.RNA processing Oc…

A: DNA synthesis inside the cell occurs when the cell decides to divide. DNA synthesis is carried out…

Q: PART C. Use your codon chart to determine the amino acid sequence. Remember to read through the…

A: the three-letter genetic code is the way by which the cell transcript the information from DNA to…

Q: Which of following statements describes a difference between replication of DNA and transcription of…

A: Replication is the process of copying of DNA to make identical copies of dna molecules. This occurs…

Q: Location/enzyme DNA Process RNA polymerase Transcription RNA transcript Ribosome Protein Translation

A: Nucleus is a main controller of the cell which carriers genetic instructions . It consists of…

Q: DNA pol 3's inability to begin the replication process is solved by which enzyme? helicase primase…

A: DNA is genetic material in most of organisms . It act as template for synthesis of its own . This…

Q: sequence is 3 A DNA sequence before and after rep from left to right. The table below shows which…

A: DNA ( Deoxyribonucleic acid ) is a genetic material in most of organism . It is two stranded ,…

Q: DNA Replication = the location DNA replication takes place is in the DNA in the Nucleus DNA…

A: Process Where 01. DNA Replication DNA replication occurs in the nucleoplasm of the Nucleus at…

Q: DNA Transcription and Translation Directions: 1. Transcribe the DNA sequences below into MRNA. Read…

A: mRNA sequence: 3'C A U A G G G A A C U G A A G U U U C C C G G G U A C U U C C C A5'

Q: Discuss DNA replication (eukaryotic)  based on your own understanding of the process. Make sure to…

A: Eukaryotic DNA replication is a highly specialised mechanism involving replication of eukaryotic DNA…

Q: AAA CC GG G CA GG CCGU Phe Gly Arg

A: * Transcription is the process of copying  DNA  segment into RNA. *The DNA segments transcribed into…

Q: DNA Template: 5' (?) MRNA (?) 3' 3' GGTCAGATGTGCGCGACGGGCAATCCGCACGTGTCATCAATAGTGCCTTCGTCTGAGATC 5'…

A: DNA subsists inside the nucleus as a double-stranded particle. Some regions of DNA include genes…

Q: Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…

A: The central dogma involves two processes to bring about gene expression, namely transcription, and…

Q: DNA Downstream G Upstream The process illustrated in the figure is: transcription. translation. a…

A: The DNA is a complex double helical strand which is located in the nucleus. Its strands are lined…

Q: Fill in the blank with the most appropriate term that is described by the following statemer…

A: During DNA replication, an RNA primer serves as a starting point for DNA polymerase , which builds…

Q: Illustrate the process of transcription by providing the correct bases for mRNA strand given the DNA…

A: Transcription is the process where the genetic information on the DNA strand is transferred into an…

Q: 1. For each of the items below, give a brief description (indicate function for enzymes) and…

A:

Q: RNA polymerases carry out transcription much more slowly than DNA polymerases carry out replication.…

A: Transcription is a process in which the DNA is transcribed into RNA with the help of the enzyme RNA…

Q: Contrast DNA replication with gene expression (transcription -> translation).

A: The central dogma of the molecular biology says that the process of formation of a functional…

Q: transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.