Mutations can be classified as small-scale or large-scale, depending on the number of nucleotides involved in the mutation. Small-scale mutations involve a change in a small number of nucleotides (usually one to three nucleotides) within a single gene. Large-scale mutations, sometimes called chromosomal mutations, involve changes in large sections of chromosomes. Determine whether each of the following small-scale mutations is a point mutation, insertion mutation, or deletion mutation. a) The sequence of nucleotides in part of a gene is changed from CCGATG to CCGGATG. insertion mutation b) The sequence of nucleotides in part of a gene is changed from CCGATG to CCGAGG. point mutation c) The sequence of nucleotides in part of a gene is changed from CCGGAG to CTGGAG. point mutation d) The sequence of nucleotides in part of a gene is changed from CCGATG to CCGACTG. insertion mutation e) The sequence of nucleotides in part of a gene is changed from CCAGATG to CCGATG. deletion mutation

Mutations can be classified as small-scale or large-scale, depending on the number of nucleotides involved in the mutation. Small-scale mutations involve a change in a small number of nucleotides (usually one to three nucleotides) within a single gene. Large-scale mutations, sometimes called chromosomal mutations, involve changes in large sections of chromosomes. Determine whether each of the following small-scale mutations is a point mutation, insertion mutation, or deletion mutation. a) The sequence of nucleotides in part of a gene is changed from CCGATG to CCGGATG. insertion mutation b) The sequence of nucleotides in part of a gene is changed from CCGATG to CCGAGG. point mutation c) The sequence of nucleotides in part of a gene is changed from CCGGAG to CTGGAG. point mutation d) The sequence of nucleotides in part of a gene is changed from CCGATG to CCGACTG. insertion mutation e) The sequence of nucleotides in part of a gene is changed from CCAGATG to CCGATG. deletion mutation

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 34CTQ: Quinolone antibiotics treat bacterial infections by blocking the activity of topoisomerase. Why does...

See similar textbooks

Similar questions

7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAGCCGTTAC 7b. Where did the mutation take place?
6a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAGCTTAC
Quinolone antibiotics treat bacterial infections by blocking the activity of topoisomerase. Why does this treatment work? Explain what occurs at the molecular level.
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
67. To make an insertion using CRISPR Cas9, one must include a DNA with flanking sequences similar to the desired target sequence to take advantage of the endogenous DNA repair mechanism known as ______________________.
22-71 Indicate whether each of the following statementsinvolving differences between DNA and RNA moleculesis true or false.a. Base pairing occurs in DNA but not in RNA.b. Both DNA and RNA are double-stranded molecules.c. RNA molecules are much larger than DNAmolecules.d. The base T in DNA is replaced by the base A in RNA
In the following sequence, a cytosine was deaminated and is now a uracil (underlined). 5’-GGTAUTAAGC-3’ a. Which repair pathway(s) could restore this uracil to cytosine? b. If the uracil is not removed before a DNA replication fork passes through, what will be the sequences of the two resulting double helices? Provide the sequences of both strands of both helices. Label the old and new strands and underline the mutation(s). c. Could the mismatch repair pathway fix the mutations you’ve indicated in part b? d. If the cell undergoes mitosis, and the replicated DNAs are distributed into the two daughter cells. Will 0, 1, or 2 daughter cells have a mutation in this sequence?
There are five substitution mutations in the dark-colored mutant Mc1r gene. Compare the DNA sequence of the light-colored wild-type Mc1r gene with the DNA sequence of the dark-colored mutant Mc1r gene. Indicate the locations of the five mutations by changing the font color to YELLOW for the five single DNA nucleotides that are mutated in the mutant Mc1r gene table. Using the information in the introduction, determine whether each of these mutations is a silent, missense, or nonsense mutation. Using the mutant Mc1r gene data, fill in the columns (including DNA, mRNA, and amino acid) in gene table 2 that contain a silent mutation with BLUE. Likewise, fill in the columns that contain a missense mutation with RED. Shade any columns that contain nonsense mutations with GREEN. Then Of the five mutations you identified in the mutant Mc1r gene, how many are: substitutions insertions deletions (Enter a number on each line.) 2. Of the five mutations…
Given that there are about 20,000 human genes, how can human cells make 75,00o-100,000 different proteins? Distinguish between missense and nonsense. Compare and contrast between insertions and deletions. Why are these called “frameshift” mutations? What are thymine dimers? What causes them?
18A. How many equivalents of ATP are required to replicate a 1000 bp stretch of DNA? B. If the incorrect nt is incorporated how many equivalents of ATP are required to fix this?
What is a silent mutation? Why is the name “silent mutation” a bit of a misnomer?
5-bromouracil is a base analog. It looks chemically similar to a thymine, and able to pair with adenine. But it often shifts to its enol form, and in its enol form, it can pair with Guanine instead of Adenine. What kind of mutation would most likely result from incorporation of 5-bromouracil into a DNA strand: insertion, deletion, frameshift, or substitution?