Na Purified protein Digest protein into small fragments using a protease. Determine the mass of these fragments with a first spectrometer. | 1652 Da 4000 Mass/charge Analyze this fragment with a second spectrometer. The peptide is fragmented from one end. Abund ance 1201 1428 1652 1008 1114 1315 1565 900 1800 Mass/charge -Asn-Ser-Asn-Leu-His-Ser- Short peptide sequences, such as this one, are used to search a database and identify the protein. FIGURE 24.6 The use of tandem mass spectrometry to deter- mine the amino acid sequence of a peptide and identify a protein. Abundance

Q: Consider the proteins in Figure 1.  Assume they are treated with chymotrypsin to cut them into…

A: Chymotrypsin:  It is a proteolytic enzyme that cuts the protein at a specific point. Proteolytic…

Q: Sir Bong wanted to determine the a amino acide sequence og BONG. The summary of the analyses…

A: Since you have posted a question with multiple sub-parts, we will solve first three subparts for…

Q: Cyanogen bromide cleavage of a peptide results in 3 fragments with the sequence: AGRFM, RS, and…

A: Cyanogen bromide (CNBr), is an inorganic pseudohalogen, which helps in modifying peptides and…

Q: Protein: Hemoglobin Circle and underline each codon, amino acid sequence, make a mutation of the 3rd…

A: Here the not cleared the mutation type, are point mutations, frame shift mutation, addition mutation…

Q: What will you come up if you need to create a protein sequence that will pe positive to both…

A: Amino acids are any organic molecules that contain an amino group (–NH2) and a carboxyl group…

Q: Shown below are eight DNA sequences from different individuals QHow many different haplotypes (sets…

A: Haplotypes are a set of alleles that are inherited together from a single parent. Allele are…

Q: Which of the following is not correct regarding protein domains or modules such as the…

A: Amino acids when combined with a peptide bond, they form proteins. Proteins are macromolecules made…

Q: Consider the λ bacteriophage DNA molecule as shown in Figure 21.14. Total digestion with the two…

A: DNA or deoxyribonucleic acid is a type of biomolecule. It is a polymer of deoxyribonucleotides…

Q: A sample of an unknown peptide was dividedinto two aliquots. One aliquot was treated with trypsin;…

A: Trypsin is an endopeptidase. It is a serine protease that cleaves after the basic residues such as…

Q: Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons are 3…

A: According to Bartleby guidelines,  we are supposed to answer first three subparts in case of…

Q: A peptide with 19 amino acid residues was digested with trypsin and generated the following…

A: The one letter code for different amino acids are :-  G - glycine I - isoleucine  R - arginine  S -…

Q: A BIOL 1000 student is provided with the primary structure of a protein and told to predict the…

A: Yes, the students were correct. DNA →RNA(have codon) →Protein The genetic code is a set of rules…

Q: Which set of fragment ions is likely from the same population of precursors ions (parent peptide)…

A: ANS:- None of the described choices are likely.

Q: After sequencing a segment of DNA you identify the following sequence: 5…

A: Answer: DNA sequence : It is the genetic sequence or the order of nucleic acids in DNA.  DNA…

Q: A protein has the opnino acid seruence that cates as follows: •N-terminas - Some More amino kids -…

A: Protein targeting or also called as protein localization is the process by which proteins get…

Q: Below is the primary sequence of a viral protein.…

A: The charge of a protein is determined by the charge of individual amino acids. The charge of…

Q: A certain small enzyme is needed to extracellularly digest food. The order of the bases on the DNA…

A: Since you have posted multiple questions, we solve the first question for you. To get the remaining…

Q: Define the following terms:a. protein motifb. conjugated proteinc. dyneind. zwitterione.…

A: Introduction: Proteins are major biomolecules that consist of long chains of amino acids. The…

Q: using the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: DNA is a double helical complex molecule which encodes all the information regarding an organism. It…

Q: After treating one polypeptide with two different proteases (Trypsin and Chymotrypsin), shorter…

A: Introduction Peptides are short chains of amino acids with peptide bonds connecting them.…

Q: Transcribe the following DNA sequence into codons.…

A: Transcription is a process in which there is formation of messenger RNA from the DNA template In…

Q: When a protein is denatured using heat Select one: a. its C-terminal will change. b. its tertiary…

A: Proteins are amino acid chains that are primarily joined by peptide bonds. However, these primary…

Q: nucleotide sequence has providen to you, you have only the name of source organism. - how will you…

A: For finding the nucleotide sequence for proteins first Use the NCBI BLAST service to perform a…

Q: A portion of an unknown enzyme has the amino acid sequence leucine – alanine – lysine – tyrosine.…

A:

Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?

A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…

Q: Which of the peptide sequences below best matches the hydropathy plot shown? 5 10 15 Residue Number…

A: Hydropathy plot is a quantitative analysis of the distribution of amino acids in a protein.…

Q: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ a.Complementary Strand: b. Direct Transcript: c. Transcript for…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: PART C. Use your codon chart to determine the amino acid sequence. Remember to read through the…

A: the three-letter genetic code is the way by which the cell transcript the information from DNA to…

Q: Complete the DNA and RNA sequencing for the translation and creation of proteins. DNA 3' CCC GGG TTT…

A: DNA is two stranded ladder like structure which act as template for synthesis of its own strand . It…

Q: Use the displayed results (use the 4th line jnetpred), find out the residues and residue ranges that…

A: The given data in the question can be used to compare the secondary structural characteristics of…

Q: A short protein segment was cleaved by two different enzymes resulting in two sets of degradation…

A: Edman degradation is a method in which amino acids can be sequenced in a peptide. At first the amino…

Q: A. For each of the following nucleotide sequences, determine the amino acid sequence. 1. 5'…

A: Introduction Amino acids are molecules that combine to form proteins, They build muscles, prevents…

Q: Examine the amino acid sequences from three organisms (A,B , and C). Which two organisms are the…

A: Amino acid sequence Organism A : Val-Ser-Thr-Val  Organism B: Leu-Ala-Leu-Ala   Organism C:…

Q: I have a mixture of 4 proteins, whose sequences are shown below (note that each protein is a…

A: Proteins or peptides are composed of twenty standard amino acids attached together via peptide…

Q: TNIS IS the SC TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT Write the amino acid sequence of the protein that…

A: Here DNA sequence is given is TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT This DNA strand work as a template…

Q: The following diagram of protein synthesis will be used for the next four questions. We will call…

A: The given image shows transcription of mRNA from DNA and then the translation to protein or…

Q: Transcribe the following DNA nucleotide sequence and determine their respective amino acid products.…

A: Transcription  Formation of RNA over DNA template is called transcription.

Q: A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein…

A: DNA is the genetic material in humans. It carries information that is transferred from one…

Q: Sickle cell anemia occurs due to a point mutation in a gené för changes the amino acid at position 6…

A: Red blood cells are small, round, and convex cells that transport oxygen throughout the body.…

Q: You are trying to determine the PTMs on your protein of interest, so you set up a mass spectrometry…

A: The modification of proteins after its biosynthesis is called post-translational modification (PTM).…

Q: 4. A peptide was cleaved into smaller fragments using chymotrypsin and CnBr. The fragments were…

A: Introduction Peptides are peptide bonds that connect short chains of amino acids. Dipeptides,…

Q: Define the following terms:a. repliconb. Okazaki fragmentc. ter regiond. tus proteine. preinitiation…

A: DNA replication is the transmission of chromosomal DNA from generation to generation is crucial to…

Q: DIRECTION: Complete the DNA and RNA sequencing for the translation and creation of proteins. 1. DNA…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: A solution of a peptide of unknown sequence was divided into two samples. One sample was treated…

A: Chymotrypsin is an endonuclease that works on the carboxyl-terminal end of the amino acids like…

Q: Protein sequences are customarily 'reconstructed from sequenced fragments because all of the above…

A: Protein sequencing is a practical method that determines the sequence of amino acids of all or some…

Q: What will you come up if you need to create a protein sequence that will me positive to both…

A: The amino acid and functional group test of protein can be done in different ways out of which…

Q: Which of the following is the primary factor that dictates how far a protein will migrate during…

A: The primary factor that dictates how far a protein will migrate during SDS-PAGE is the size of the…

Q: Western blotting does not allow you to :   eatimate the size of a protein    estimate the…

A: Western blotting is one of the protein purification technique and it uses SDS-polyacrylamide gel…

Q: Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the…

A: The sequence are:

Q: Using the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: Proteins are the building blocks of the body. Proteins are made up of amino acids. All the…