Under what conditions will the following partial diploid strain of E. coli convert chorismate to tryptophan (assume trp mutants function similarly to lac mutants)?trpR* trpP trpO* trpE* trpD* trpC* trpB* trpA*/trpR trpP trpO° trpE trpD trpC trpB trpAect the one BEST answer (2oints!O neverO only when tryptophan levels are lowO constitutivelyO only when tryptophan is presentO only when chorismate levels are low

Tryptophan is used by the body to make melatonin and serotonin. Melatonin aids in the regulation of…

nder what conditions will the following partial diploid strain of E. coli convert chorismate to tryptopl OR* trpP trpO* trpE* trpD* trpC* trpB* trpA*/ OR trpP trp0 trpE trpD trpC trpB trpA BEST O never O only when tryptophan levels are low O constitutively O only when tryptophan is present O only when chorismate levels are low

nder what conditions will the following partial diploid strain of E. coli convert chorismate to tryptopl OR* trpP trpO* trpE* trpD* trpC* trpB* trpA*/ OR trpP trp0 trpE trpD trpC trpB trpA BEST O never O only when tryptophan levels are low O constitutively O only when tryptophan is present O only when chorismate levels are low

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter17: Bacterial And Viral Genetics

Section: Chapter Questions

Problem 1ITD

See similar textbooks

Similar questions

. An Hfr+ strain is used to map three genes: ala, leu, and thr in an interrupted mating experiment. Hfr/ala+, leu+, thr+, camS x F-/ala-, leu-, thr-, camR The cross is initiated at time = 0, and at various times, the mating mixture is plated on three types of medium. Each plate contains minimal medium with chloramphenicol and the amino acids as listed in the table. The data represents the number of colonies growing on each plate. Time of interruption Nutrients added 5 min 10 min 15 min 20 min alanine, leucine 8 21 58 85 leucine, threonine 0 3 19 46 alanine, threonine 0 0 7 16 Based on these data, what is the order of gene transfer relative to one another and to the F-factor.
A pure culture of an unknown bacterium was streaked onto plates of a variety of media. You notice that the colony morphologyis strikingly different on plates of minimal media with glucose compared to that seen on trypticase soy agar plates. How can you explain these differences in colony morphology? Also, describe what happens when a nonsense mutation is introduced into the gene encoding transposase within a transposon and why is it more likely that insertions or deletions will be more detrimental to a cell than point mutations?
A scientist is researching GS1, an enzyme with a relative molecular mass (Mr) of 78,000 present in a bacterium. The scientist has isolated two mutant strains of the bacterium as described below. Strain A: In this strain the GS1 protein is completely non-functional. Analysis of strain A shows that it produces a shortened GS1 protein with an Mr of only 38,000. Strain B: This produces functional GS1, but the Kcat is somewhat reduced. Analysis shows it produces a lengthened form of GS1, with an Mr of about 86,000. Sequencing of the GS1 gene from strain B shows that it is identical to the wild type gene except for a single alteration (the replacement of one nucleotide by another). How might this account for the features of the GS1 protein produced by strain B?
A scientist is researching GS1, an enzyme with a relative molecular mass (Mr) of 78,000 present in a bacterium. The scientist has isolated two mutant strains of the bacterium as described below. Strain A: In this strain the GS1 protein is completely non-functional. Analysis of strain A shows that it produces a shortened GS1 protein with an Mr of only 38,000. Strain B: This produces functional GS1, but the Kcat is somewhat reduced. Analysis shows it produces a lengthened form of GS1, with an Mr of about 86,000. What type(s) of mutation may have occurred in the GS1 gene in strain A?
A scientist is researching GS1, an enzyme with a relative molecular mass (Mr) of 78,000 present in a bacterium. The scientist has isolated two mutant strains of the bacterium as described below. Strain A: In this strain the GS1 protein is completely non-functional. Analysis of strain A shows that it produces a shortened GS1 protein with an Mr of only 38,000. Strain B: This produces functional GS1, but the Kcat is somewhat reduced. Analysis shows it produces a lengthened form of GS1, with an Mr of about 86,000. The scientist determines the nucleotide sequence of the coding strand of the GS1 gene from strain A. It is identical to the GS1 sequence from the wild type gene except for a single change occurring approximately 1⁄3 of the way into the GS1 open reading frame. A small region of the GS1 sequence (including the site where the mutation occurs) from the wild type and mutant strains is shown below. Wild type TGTCCTCGGCCACAAGTTCTCTATC Strain A TGTCCTCGGCCACTAGTTCTCTATC How has this…
b. Compounds A, B, C, and D are known to be intermediates in the pathway for production of protein E. To determine where the block in protein-E production occurred in each individual, the various intermediates were given to each individuals cel Is in culture. After a few weeks of growth with the intermediate, the cells were assayed for the production of protein E. The results for each individuals cells are given in the following table. A plus sign means that protein E was produced after the cells were given the intermediate listed at the top of the column. A minus sign means that the cells still could not produce protein E even after being exposed to the intermediate at the top of the column. Denote the point in the pathway in which each individual is blocked.
a. Compounds A, B, C, and D are known to be intermediates in the pathway for production of protein E. To determine where the block in protein-E production occurred in each individual, the various intermediates were given to each individuals cel Is in culture. After a few weeks of growth with the intermediate, the cells were assayed for the production of protein E. The results for each individuals cells are given in the following table. A plus sign means that protein E was produced after the cells were given the intermediate listed at the top of the column. A minus sign means that the cells still could not produce protein E even after being exposed to the intermediate at the top of the column. Draw the pathway leading to the production of protein E.
In E. coli, four Hfr strains donate the following markers,shown in the order donated:Strain 1: M Z X W CStrain 2: L A N C WStrain 3: A L B R UStrain 4: Z M U R BAll these Hfr strains are derived from the same F+ strain.What is the order of these markers on the circularchromosome of the original F+?
For E. coli strains with the lac genotypes show below, use a plus sign (+) to indicate the synthesis of β-galactosidase and permease and a minus sign (–) to indicate no synthesis of the proteins.
The pathway for arginine biosynthesis in Neurosporacrassa involves several enzymes that produce a seriesof intermediates.ARG-E ARG-F ARG-G ARG-HN-acetylornithine → ornithine → citrulline → argininosuccinate → argininea. If you did a cross between ARG-E− and ARG-H−Neurospora strains, what would be the distributionof Arg+ and Arg− spores within parental ditype andnonparental ditype asci? Give the spore types inthe order in which they would appear in the ascus.b. For each of the spores in your answer to part (a),what nutrients could you supply in the media to getspore growth?
Several genes code for enzymes that are responsible for histidine biosynthesis in Escherichia coli. Part of the nucleotide sequence of the gene that codes for one of these enzymes is: AUG CCU UGG GCC CAA AAA UGC A series of mutants that have lost activity for this enzyme are recovered. The mutant products are analyzed and found to have the following amino acid sequences: Mutant 1: Met-Pro-Trp-Pro-Glu-Lys-Cys Mutant 2: Met-Pro Mutant 3: Met-Pro-Cys-Gly-Pro-Lys-Met Mutant 4: Met-Pro-Trp-Pro-Lys-Asp Choose the correct type of mutation that occurred in the DNA to produce each mutant type. Nonsense:Missense:Addition:Deletion:
The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG