Set of chromosomes Add PCR primers. The PCR primers specifically recognize sequences on chromosome 2 that flank a particular microsatellite. Microsatellite- Microsatellite Many cycles of PCR produce a large amount of the DNA fragment contained between the 2 primers. The DNA is subjected to gel electrophoresis. Microsatellite with more repeats - Microsatellite with fewer repeats FIGURE 23.5 Identifying a microsatellite using PCR primers.

Set of chromosomes Add PCR primers. The PCR primers specifically recognize sequences on chromosome 2 that flank a particular microsatellite. Microsatellite- Microsatellite Many cycles of PCR produce a large amount of the DNA fragment contained between the 2 primers. The DNA is subjected to gel electrophoresis. Microsatellite with more repeats - Microsatellite with fewer repeats FIGURE 23.5 Identifying a microsatellite using PCR primers.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Similar questions

In an electrophoretic gel across which is applied a powerful electrical alternating pulsed field, the DNA of thehaploid fungus Neurospora crassa (n = 7) moves slowlybut eventually forms seven bands, which represent DNAfractions that are of different sizes and hence havemoved at different speeds. These bands are presumed tobe the seven chromosomes. How would you show whichband corresponds to which chromosome?
Is it more indicated for ageneticist desiring to map theX chromosome of the motherof a given family (theresearcher does not haveaccess to her DNA, only accessto the genetic material of theoffspring) to analyze thechromosomes of herdaughters or of her sons?
Analyzing Karyotypes 1. Originally, karyotypic analysis relied only on size and centromere placement to identify chromosomes. Because many chromosomes are similar in size and centromere placement, the identification of individual chromosomes was difficult, and chromosomes were placed into eight groups, identified by the letters A to G. Today, each human chromosome can be readily identified. a. What technical advances led to this improvement in chromosome identification? b. List two ways this improvement can be implemented. c. What clinical information does a karyotype provide?
With regard to the analysis of chromosome structure, explain theexperimental advantage that polytene chromosomes offer. Discusswhy changes in chromosome structure are more easily detected inpolytene chromosomes than in ordinary chromosomes.
Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin numerical digits only.
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
Given the following metaphase chromosomes, please complete the table. Thank you
To which chromosome and which band does the sequence localise? Write the location in the standard format: e.g. 8q21.3, not Chr 8 (q21.3). *clone number in this case is 196 which is shown in the images*
Morphology of Chromosomes can bebest studied at ______A. Interphase B. ProphseC. Metaphase D. Zygotene
Linkage and Gene Mapping
why The chromatids formedby recombination within the inversion loop of a paracentric inversionheterozygote containtwo centromeres or none, instead of the normal one ?
Giemsa stain produces G bands in metaphasechromosomes. The pattern of G bands is highly specificand reproducible, allowing identification of _____________-and gene locations.