Below are two sequences of a segment of DNA. Normal sequence TAG GTC CÁC Mutated sequence TAG GTC CCC Which type of mutation has occurred?

Q: • a DNA ladder with markers every 200 bp (DNA Ladder) • the resulting restriction fragments of the…

A: Restrictions endonuclease Restriction endonuclease are the enzymes which cleaves the DNA at the…

Q: What type of mutation occurred to produce the abnormal sequence (nonsense or missense)? Explain your…

A: A mutation is a change in a DNA sequence.

Q: List the steps in correct order of DNA mismatch repair in E. coli Group of answer choices Mut H; Mut…

A: There are three mismatch repair system in E.coli. On the basis of the relative length of the…

Q: The following sequence of nucleotides is found in a single-stranded DNA…

A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…

Q: If this is the original sequençe of a DNA strand: CCAGGTCCATGACTTAGC, how would you labeled the one…

A: It is an alteration in the nucleotide sequence of the genome of an organism.

Q: What kind of mutation is present in the following DNA strand?: Wild-type: 3'-AGTCCCTGAAAT-5'…

A: Introduction : Mutation is defined as a change in the DNA sequence. Mutation is an alteration that…

Q: Which type of mutation involves only one base pair? a. insertion b. deletion c. inversion d.…

A: A mutation occurs when DNA molecules are copied or replicated, resulting in DNA variants that can be…

Q: Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’ Amino acid sequence of peptide:…

A: Point mutation

Q: I mutation occurs such that the sequence now reads: CTA CTT TTT. A) Transcribe the short DNA…

A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…

Q: Eddie the E. coli bacterium cell is suspicious that his DNA contains a thymine dimer. What is the…

A: Here in the question it is described that DNA thiamine dimer is formed. And it's proposed that DNA…

Q: ⦁ Original: ATTTGAGCC Mutated: ATTGAGCC. This is an example of what kind of mutation?

A: The alteration, damage, or change in the gene of DNA occurs which can change the genetic information…

Q: Below is a DNA strand.  We will call this the original strand, and you will transcribe and translate…

A:

Q: In 1984, Carolyn Greider was using out the enzyme called telomerase that had the ability to add…

A: Chromosomes are the structures formed by the organised arrangement of the DNA molecules located…

Q: Normal DNA : AUGATGTGTGTTAAA Mutant DNA: AUGATGTGAGTTAAA, what is the type of mutation? silent…

A:

Q: explain the following terms: genomics, mutations(variants) & proteomics

A: The genome is a cell's entire collection of genetic material. In humans, the genome is made up of 23…

Q: G* is a base analog. It usually acts like A. But, when the right mood hits, it pairs up with A.…

A: In human DNA four types of nucleotide are present adenine (A)  , guanine (G) , thymine (T) ,and…

Q: Normal DNA : AUGATGTGTGTTAAA Mutant DNA: AUGATGTGAGTTAAA, what is the type of mutation? * silent…

A: Whenever a DNA gene is destroyed or altered in such a manner that the genetic information provided…

Q: What type of mutation is represented in the second strand of DNA?…

A: A mutation is an alteration or abnormality in a DNA sequence. It can result from DNA copying…

Q: ntify the type of mutation and how it would affect the protein made (amino acid) if the following…

A: DNA is what is inside the nucleus of mostly all cells. It carries the genetic information which is…

Q: DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl…

A: DNA polymerase is an enzyme involved in the synthesis of DNA molecules by joining the dNTPs…

Q: How many potential methylation sites are present for the following DNA strand?…

A: 3 types of methylation sites. option 2 is the correct answer. Count the number of "C"s and "T"s at…

Q: Can I get a breakdown on usher sydrome affected mutations?

A: Usher Syndrome is classified into 3 subtypes(I, II, and III) , depending on the genetic responses…

Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…

A: We are answering four parts  For rest of parts pls repost.

Q: The most common source of DNA mutation is _____; however, these mistakes are typically corrected.​…

A: To understand the structure of nucleic acid, it is necessary to first understand the structure of…

Q: GAATTC GAATTO CITAAG CITAAG double-stranded DNA DAATT DAATTO CTAA G CTAA GI AAT TO CTTAA GAATTO…

A: The cloning is routinely used in biotechnology laboratories and it is the process by which a foreign…

Q: Three common ways to repair changes in DNA structure are nucleotideexcision repair, mismatch repair,…

A: DNA repair, it is a mechanism by which a cell recognise, or identify the mutations, damage, or any…

Q: Is each of the following mutations a transition, transversion, addition,or deletion? The original…

A: Since no specific subparts have been asked to be answered, the first three subparts have been…

Q: The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If…

A: DNA sequencing is used to determine the exact arrangement of the nucleotide bases adenine (A),…

Q: Which of the following represents a base analog acting as a mutagen? O ethidium bromide O guanine O…

A: In hereditary qualities, a mutagen is a physical or compound specialist that changes the hereditary…

Q: If a hypothetical "wild type" DNA sequence is: THE BIG BAD CAT ATE THE FAT RED BUG, then what type…

A: DNA (deoxyribonucleic acid) is a ploymer of nucleotides such as adenine, guanine, cytosine and…

Q: The Deoxyribonucleic Acid (DNA) is made up of What type of mutation does not affect a proteii 1.…

A: DNA  It is a heritable molecule which transfer from parents to their offsprings. It contains all the…

Q: Original DNA Sequence: T A C G C A A A A A T C G A T C G A A C T mRNA Sequence: Amino Acid Sequence:…

A: There are various types of mutation that takes place in the DNA sequence among which the three basic…

Q: Silent mutation: Single substitution mutation when the change in the DNA base sequence results in a…

A: A mutation is defined as the change in the sequence of DNA of a cell in organisms or viruses. These…

Q: Which of the following best describes this type of mutation? Original – CCU-GAU-GAG-UCA…

A: Introduction : Mutations are modifications to the genetic sequence. Mutations can involve the…

Q: 8. What polypeptide sequence does the inserted gene code for? (Review protein synthesis and write…

A: The given question is based on the activity of the t rna that produces the protien by recognising…

Q: Identify the type of mutation and how it would affect the protein made (amino acid) if the following…

A: Mutations can be defined as the sudden changes which occur in DNA. These changes can be a result of…

Q: The first 15 bases of the original informational strand of DNA (which continues after what is shown)…

A: Mutation is the change in DNA sequence caused due to various factors. Mutations take place during…

Q: Hello,  I have already asked for help with this question but whoever answered it copied the DNA…

A: Gene expression is the conversion of DNA into a biologically functional amino acid polypeptide…

Q: What type of mutation is represented in the second strand of DNA? 1.      TACGGCACT 2.…

A: Mutation is the sudden inheritable change. The process by which mutation occurs is called as…

Q: DNA before and after mutation. Which of on. Which of the following are CORRECT about the types of…

A: Mutation is the change in the nucleotide of the DNA sequence which ultimately affects the Amino acid…

Q: An original DNA sequence retrieved from the gametes of a female Golden Retriever and a mutated DNA…

A: DNA is two stranded structure , present bin double helix and is a genetic material in most of…

Q: Evaluate the mutation below. Original DNA strand: 3'-TACTTACGCACGGCCACT-5' Amino acids produced:…

A: From the DNA sequence the mRNA is produced within the nucleus of the cell by the transcription…

Q: The following nucleotide sequence is found on the template strand of DNA. First, determine the amino…

A: Amino acids are the amine groups consisting of carboxylic acids and a side chain which forms the…

Q: The following is an example of what type of mutation? Normal DNA: 5' - ATGACGTCA - 3' Mutated DNA:…

A: Thank you for the question  Answer = The correct answer is option A (Deletion). Explanation :- This…

Q: Which of the following mutational changes wouldyou predict to be the most deleterious to gene…

A: Introduction :- A mutation is a change in our DNA sequence that happens as a result of errors in DNA…

Q: The accompanying photo shows a sequencing gel from the original study that first sequenced the…

A: Cystic fibrosis is a type of inherited disease that will cause serious damage to the digestive…

Q: Several proteins involved in DNA repair are used in multiple pathways. Which one of the following is…

A:

Q: A fragment of DNA has the sequence 5'-ATCCGCT-3'. Following DNA replication, the complementary…

A: Introduction Mutation is defined as the changes in the genetic material of an organism. Mutation can…

Q: Chimeric DNA true are all except - a) Formed by linking DNA fragments of unrelated nis ood l nsvi…

A: Chimeric  DNA is also known as recombinant DNA which is formed by linking DNA fragments of two…