you carry out DNA editing using CRISPR whter the editing template DNA has strands labeled with heavy nitrogen 15N. The experiment is carried out in presence ofnormal light isoptope 14 N. The expected distribution of the isotope in the strands in the edited region of the target DNA would be: 1. only one strand is labeled iwth 14 N and the other with 15 N 2. both srrands are labeled with 15 N 3. both strands are labeled with 14 N

you carry out DNA editing using CRISPR whter the editing template DNA has strands labeled with heavy nitrogen 15N. The experiment is carried out in presence ofnormal light isoptope 14 N. The expected distribution of the isotope in the strands in the edited region of the target DNA would be: 1. only one strand is labeled iwth 14 N and the other with 15 N 2. both srrands are labeled with 15 N 3. both strands are labeled with 14 N

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 19QP

See similar textbooks

Similar questions

Restriction enzymes recognize palindromic DNA sequences (i.e. sequences that read the same on both strands). An example of such a sequence is GAATTC – work out the reverse complement of this sequence if you need to convince yourself that it’s a palindrome. Write the sequence of a different six nucleotide palindromic DNA sequence that uses all four nucleotides – you only have to give the sequence of one strand, but you’re welcome to write out both.
Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
You digest 4 uL of plasmid DNA that is 50 ng/uL concetration in a total volume of 20 uL. You run 10 uL of the digest on teh gel. You then do a DNA purification protocol with a Zippy prep on the remaining digested DNA. You elute the DNA in a 25 uL. A 2 uL ssample has the concentration of 2 ng/uL. What is the DNA yield? YIELD = How much dna came out of the column/how much DNA was loaded onto the columnRemember to subtract amount of DNA run on gel from total digested DNA to get hw much DNA was loaded onto the columnAmount that came out of the column equals the volume of the eluted DNA times the concentration of the purified DNA
You want to make a recombinant DNA in which aPCR product amplified from the human genome is inserted into a plasmid vector. The polylinker of thisvector includes recognition sites for the enzymesEcoRI (5′ G^AATTC 3′) and BamHI (5′ G^GATCC3′). (The ^ symbolizes the cut site in the DNA.) PCRprimers that could amplify the fragment of humanDNA are: 5′ GCTACTTCGCGTATTCCA 3′ and5′ CCCAAGTCCTAGCCGATA 3′.a. Describe in detail how these primers would need tobe modified to create a fragment of the human genome flanked by EcoRI sticky ends so that thisfragment could be cloned easily into the plasmidvector. You will need to consider the fact that mostrestriction enzymes, including EcoRI, cannot cutDNA if the restriction site is directly at the end ofthe DNA molecule; the restriction enzyme recognition site must be at least six base pairs distant fromthe end.b. Describe a potential feature of the PCR-amplifiedregion of the human genome that could prevent youfrom using the strategy you described in…
All ingredients required for the synthesis of DNA were placed in a test tube. The primer has the sequence 5’-TCGATCA-3’. First determine where the primer will bind to the DNA template given below (Do this by writing the sequence of the primer on top of the template – make sure you find a location that is complementary in sequence and that the primer is antiparallel with respect to the template) and then indicate the nucleotides that DNA polymerase would attach onto the primer as it synthesizes DNA (hint: in which direction does DNA polymerase attach nucleotides onto a primer?) See figure 13.16 in book. 5’-GACGTAGTCTGATGCTAGCATGCTGATCGAAAGAG-3’
a)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x 10-14g of a 10 kb template in a 100 µl reaction. Assuming that the molecular weight of the average base pair is 660 Daltons calculate the number of molecules of the template. b)Given that the concentration of each primer (20 base pairs each) is 0.1µM in this same reaction volume (100 µl) calculate the number of molecules of the primer present
You isolated a 10,500 base pair plasmid (supercoiled, cccDNA) from E. coli. The plasmid contains one unique recognition site for EcoRI, a restriction enzyme. Restriction enzymes recognize a specific sequence and cut both strands of the DNA at that sequence (Chapter 7). Brief DNase I treatment breaks one (or very few) phosphodiesterbonds in each DNA molecule, leaving the double-stranded DNA with one strand broken but the other strand intact, i.e “nicked.” You briefly incubated the cccDNA at 37°C in four separate reactions containing the components listed below. You ran each reaction sample on an agarose gel and visualized the DNA using ethidium bromide and UV light. The reactions included the appropriate buffer and ATP when required. An agarose gel containing four lanes of possible products is given below. Please refer to Figs. 4-26 and 4-27 in Watson for reference. For each reaction, indicate which lane of the gel contains the products that you would expect to see on your…
You digest 4 uL of plasmid DNA that is 50 ng/uL concetration in a total volume of 20 uL. You run 10 uL of the digest on teh gel. You then do a DNA purification protocol with a Zippy prep on the remaining digested DNA. You elute the DNA in a 25 uL. A 2 uL ssample has the concentration of 2 ng/uL. What is the DNA yield?
The restriction endonuclease BamHI recognizes the sequence GGATCC and cleaves between the Gs (in both strands). The enzyme Bgl II recognizes AGATCT and cuts between AG (in both strands). Justify your answers. 1. Draw the double stranded sequences of the DNA pieces shown above and indicate with an arrow the cutting points for each of the enzymes. Use different two colors for the two different sequences (one color for BamHI and another one for BglII). Do they generate blunt ends or sticky ends? 2. Draw the two sequences arising from each the cut (there will be four sequences).
I. You wish to perform an electrophoretic resolution of your restriction enzyme–digested DNA. The sizes of the expected fragments range from 100 to 500 bp. You discover two agarose gels polymerizing on the bench. One is 0.5% agarose; the other is 2% agarose. Which one might you use to resolve your fragments? I. What does it mean to “denature” a protein and why is this important for SDS PAGE? II. Describe how you denatured the proteins you used for SDS-PAGE. III. Describe the roles of the primary Antibody and the secondary Antibody during an ELISA test. IV. After the addition of the secondary Antibody, how did you determine which wells contain the Antigen bound to primary Antibody bound to secondary Antibody?
Image 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given below ? 5’ACTGAGTCCATGCGATCATGACTAT 3’ 3’TGACTCAGGTACGCTAGTACTGATA 5’ this is a hypothetical example. In a real experiment Choose 5’ TGAC 3’ 5’ CTAT 3’ 5’ ACTG 3’ 5’ ATAG 3’ Image2. the template strand?The results of a gel-based sequencing experiment are shown below. What is the sequence, written Only include nucleotides (no spaces or numbers )
Watch the demonstration video on nucleic acid quantification on the NanoDrop spectrophotometer: https://cutt.ly/bio150dnaquantification Note: the video is entitled RNA but the method is identical for DNA quantification. 1. Protocols in isolating DNA often involve the use of two kinds of ethanol, 100% ethanol and 70% ethanol, in succession. What happens during these steps and why are they essential?2. Spectrophotometric detection of nucleic acids require readings at wavelengths of 260nm, and 280nm. What is the significance of these wavelengths?