TRANSCRIPTIONThe DNA provided for your animal is one side of the double helix.DNA - MRNA| 1. Transcribe the DNA strand into MRNA. Don't forget the special base pairrules for RNA!AUTAveRSIon 22. Translate the MRNA into an amino acid chain. Notice that this is broken into 1i nucleotide sequences called CODONS. Use the codon chart to find thei correct amino acids. Remember, translation for each chain always starts with theamino acid methionine (Met) and ends with one of the stop codons (UGA, UAG, UAA).C GG CIGG GGI G IC CIC IAG CIA AIC Iac IGG ACG ccc AccAI GDNATACGGTATIMRNAAADNATACCATI ACCGIcCcIC GGTTA IC IA C A AC AGGCCIIIGGCTCCGACIMRNAAADNAI ACI T GGIICICCIGICI A C A ACIIACCAICGAIT G G GGTGITAG A T CMRNAAADecide if you want to illustrate a horse, coyote. or a cat - get the phenotype information from your teacher.

Name: TRANSCRIPTIONThe DNA provided for your animal is one side of the doub
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: TRANSCRIPTIONThe DNA provided for your animal is one side of the double helix.DNA - MRNA| 1. Transcribe the DNA strand into MRNA. Don't forget the special base pairrules for RNA!AUTAveRSIon 22. Translate the MRNA into an amino acid chain. Notice tha

Transcription is the process of producing RNA called mRNA from a DNA molecule, which codes for the…

Answered: Transcribe the DNA strand into MRNA.…

Science

Biology

Transcribe the DNA strand into MRNA. Don't forget the spe rules for RNA! ranslate the MRNA into an amino acid chain. Notice that th

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 18RQ: A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell...

See similar textbooks

Similar questions

A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation? Translation stalls after the initiation AUG codon is identified The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites The ribosome cannot interact with mRNAs tRNAs cannot exit the E site of the ribosome.
RNA differs from DNA because: a. RNA may contain the pyrimidine uracil, and DNA does not. b. RNA is always single-stranded when functioning, and DNA isalways double-stranded. c. the pentose sugar in RNA has one less O atom than thepentose sugar in DNA. d. RNA is more stable and is broken down by enzymes lesseasily than DNA. e. RNA is a much larger molecule than DNA.
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to:a. the rightDNA:mRNA:polypeptide chain:b. the leftDNA:mRNA:polypeptide chain:
From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 8
From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change the third base in codon 4 to show missensemutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 4
codon: 1 2 3 4 5 6 7 sequence: TAC ATG GAC AAT GAT TAG GGG 1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located . What mutation(s) would eliminate peptide translation? Use the codon numbers to help describe where the mutation is located
1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…
Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTCThen list in order the amino acids coded by this sequence.mRNA ________________________________________________________________amino acids ________________________________________________________________ 2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of themRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codonwould be AUA. Write the sequence of amino acids that would be formed.__________________________________________________________________________
Which choice best fits the blank? Refer to picture. The ribosome moves along the mRNA strand. In panels b, c, and d, new tRNAs carrying ___________. match up with the codons of the mRNA strand. After each tRNA locks into place, a peptide bond forms between the amino acid the tRNA is carrying and the amino acid already there. This process repeats until the end of the sequence is reached. A. ProteinsB. NucleotidesC. Amino Acids
DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.
1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located