Part I: Study the diagrams below, which show carbohydrate molecules. Beside each molecule, write whether it is a monosaccharide, a disaccharide, or a polysaccharide. 1. 3. CH,OH 2. CH,OH но H. он H. OH H H. HOCH, O Upto 1000 H. more Н но CH,OH OH HO OH H CH H0 он H moromers но OH H OH но н H OH H OH OH OH Gucone Gucone sbunt Guoone Fructose subunit Glucose subunit sburit subunit 4. What is the function of #1 in our bodies? 5. What is the function of #3 in our bodies? 5. What is the name of the chemical process that joined the disaccharide and the polysaccharide? What is a disaccharide? Draw the reaction of two glucose molecules that combine to form maltose (draw the structures)

Q: can you Illustrate and explain a back crossing

A: Backcrossing can be defined as a crossing of a hybrid with one of its parents or with an organism…

Q: Because of the constant exchange of blood calcium and bone calcium, the concentration of calcium…

A: The calcium concentration in the blood is tightly regulated because of the importance of calcium for…

Q: Discuss the principles and applications of Laser-Doppler Anemometer to Agricultural and Biosystems…

A: Laser-Doppler anemometers (LDAs) are non-intrusive optical instruments that can be used to measure…

Q: Please provide evidence supporting or refuting the following statement: Humans consume microbes…

A:

Q: specific strategies used by health professionals patients, and the general public to prevent…

A: Antibiotics are the drugs(medicine ) used to treat the bacterial infection. There are so many…

Q: Because of oxygen and nutrient requirements, cells in a tissue must reside within 100 μm of a blood…

A: Mammalian cells require nutrients and oxygen to survive, so they are found within 100 to 200 mm of…

Q: What are ferns? Describe its salient features.

A: A pteridophyte is a type of vascular plant that spreads spores. Pteridophytes do not produce flowers…

Q: what structure prevents food from entering the windpipe?

A: The trachea is often called the windpipe. It's a key part of our respiratory system. When we breathe…

Q: You are performing an experiment with liquids on your backyard. One morning, you observed that the…

A: INTRODUCTION Gene code is the sequence of nucleotides in DNA and RNA that codes for particular amino…

Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…

A: DNA ( Deoxyribonucleic acid ) is two stranded structure which functions as genetic material in most…

Q: After you complete an assessment of a patient in a clinical area or in a simulation laboratory,…

A: There are few important points about an assessment of patient in a clinical area and main points…

Q: in Asignacion x What is the xE Untitled do x 234610#question-179879-49 Q O * * a O Dasaoo eO…

A: Antibiotics treat bacterial infections. Fungi cause infections like athlete's foot, yeast…

Q: what steps will be appropriate if the cavity has only 0.5mm of remaining dentin before entering the…

A: Dentin is the part of the tooth that is beneath the enamel and cementum. It contains microscopic…

Q: In an in situ hybridization experiment, a certain clonebound to only the X chromosome in a boy with…

A: In situ hybridization is a sort of hybridization in which a labelled complementary DNA, RNA, or…

Q: Which of the following are safe havens for transposableelement insertions?a. Intronsb. Exonsc. Other…

A: Transposing elements or the transposons are also known as the jumping genes. A transposable elements…

Q: The genes that codes for the creation of certain blood groups are located on chromo- some "Xp22.3",…

A: Blood Inheritance Our blood type, like our eye or hair colour, is inherited from our parents. Each…

Q: Dicuss a strategie for Diabetes in the UK.

A: Blood glucose is the main source of energy and it comes from the food we eat. Diabetes is a disease…

Q: What possible solutions can be used to address the problem of freshwater crocodiles became…

A: The Freshwater Crocodile is slender-snouted and smaller in size. They are grey to tan-brown in…

Q: Adaptive Immunity Briefly describe the adaptive immune response to Canine Parvovirus .

A: Adaptive immunity is likewise referred to as acquired immunity or particular immunity and is only…

Q: 1. Embryonic stem cells continuously divide and remain undifferentiated. In order to maintain this…

A: Answer 1:- There are the following genes which are required to exhibit pluripotency:- Pou5f1 Oct4…

Q: Two particular contigs are suspected to be adjacent, possibly separated by repetitive DNA. In an…

A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…

Q: What is the purpose of generating a phenocopy?

A: The phenocopy phenomenon is easily translated and is used for the process of drug discovery. This is…

Q: 9. Two varieties of pumpkin with different weights were crossed: 5 Ib. and 29 Ib. 3/195 of the F2…

A: "Phenotype" surely refers to an observable trait. "Pheno" truly approaches "take a look at" and is…

Q: 11. Choose from the following types of inheritance and write in the 1" column which one is described…

A: Please follow step 2 for a detailed explanation of the inheritance mode of the given situations.

Q: Give two vegetative and two floral differences between grasses and sedges

A: Grasses are the member of family Poaceae  and sedges are the member of family Cyperaceae. Both shows…

Q: List common modes of reproduction in Algae?

A: Algae -  These are  group of aquatic, photosynthetic, and nucleus containing organisms . they lack…

Q: 6. Assume height in a particular plant to be determined by 2 pairs of unlinked polygenes, each…

A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…

Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…

A: Let suppose the coat colour is controlled by the gene A, As there are many traits for the coat…

Q: 2. How can you help preserve the rich species diversity of the Philippines? 3. Why is it important…

A: Biodiversity means different types of life forms or species that exist on the earth. Human…

Q: describe the process of lysosomal hydrolase arriving to the lysosome. without including translation

A: The targetting of lysosomal enzyme depends on GERL system. Lysosome, Golgi bodies, endoplasmic…

Q: To live on a large planet with strong gravity, a cold, dry climate, and a thin atmosphere, what…

A:

Q: QUESTION 6 A population's carrying capacity (K) is the size at which the population O is the largest…

A: Here we provide a brief explanation of carrying capacity of a population.

Q: When Replacement of the original gene occurs ?

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…

Q: If you are having a fever, you are in your  A. zone of physiological stress B. zone of intolerance…

A: An individual has a fever assuming their internal heat level rises the ordinary scope of 98-100°F…

Q: Why might exome sequencing fail to identify a diseasecausing mutation in an affected person?

A: Exome sequencing, often called whole exome sequencing (WES), is a genomic approach that involves…

Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 lb. 3/195 of the F2…

A: Parent  aabbccdd = 5lb AABBCCDD= 29 lb

Q: Jim’s jaundice is caused by the accumulation of bilirubin in his blood and tissues. What is the…

A: Jaundice Jaundice is the yellow discoloration of sclera ,skin and mucous. it is a characteristic of…

Q: 1. What are the target cells of SARS-CoV-2? What do these cells have in common?

A: Many scietific studies have confirmed that SARS-CoV-2's spike protein attaches to…

Q: 4. The pre-mRNA encoded by the gene for calcitonin undergoes alternative processing to yield two…

A: Alternative splicing of precursor mRNA is an essential mechanism to increase the complexity of gene…

Q: Let's Apply In each of the following DNA sequences, write on your answer sheet the corresponding…

A: DNA ( Deoxyribonucleic acid ) is two stranded helical structure which act as genetic material in…

Q: What exactly does the phrase "FMS option" imply and what is its significance?

A: Exercise also aids in the reduction and alleviation of pre-existing health problems. Exercising…

Q: Location/enzyme DNA Process RNA polymerase Transcription RNA transcript Ribosome Protein Translation

A: Nucleus is a main controller of the cell which carriers genetic instructions . It consists of…

Q: 5' AUGAGGAUGGCCAGUCAAUUUGA 3' 5' AUGGAUGGCCAGUGCAUUUGA 1. Missense 3' 2. Silent 5'…

A: Frameshift deletion occurs when one or more than one nucleotide in a nucleic acid is removed,…

Q: Are there any parts of the human body that get oxygen directly from the air and not from the blood?

A: *oxygen is an important gases for human body each cell in human body requires amount to oxygen for…

Q: a. The eyeless gene is required for eye formation inDrosophila. It encodes a homeodomain. What would…

A: Pax 6 genes are the types of gene that is essential for the development of eyes. This transcription…

Q: factor dimers, results in the phosphorylation of an array of tyrosine residues present in…

A: The JAK-STAT signaling pathway is a chain of interactions between proteins in a cell, and is…

Q: Compare the structures and functions of the receptor molecules for salty and sour taste; the…

A: In our body, taste receptors are that kind of receptors who can senses the taste of food in oir…

Q: In the garden pea, yellow pods (yp) are recessive to green pods (Yp) and straight tendrils (ct) is…

A: Given that, a plant with yellow colored pods and straight tendrils was crossed to a plant with green…

Q: I1. Electrical impulses in muscle fibers are called 12. Groups of muscle fibers are that are…

A: The movement of skeleton muscles is voluntary in nature and regulated by central nervous system.…

Q: Circulation II Which vessel direstly drains the given organ/structure in the cat? Spleen Small…

A: Introduction :- Circulation is the mass flow of fluid through the tissues and organs of an animal…

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). 

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.