protein. You create a mouse line with Cas9 under control of a brain-specific enhancer, while the short guide RNA complementary to the first exon of Gene Y is expressed in all tissues. You subsequently sequence Gene Y in both brain and liver tissue. What would expect in each tissue? You can assume that the CRISPRICas9 system will impact both copies of Gene Y in cells, and that the first exon of Gene Y is necessary for Gene Ys function. a. Liver: Functional Gene Y; Brain: Functional Gene Y b. Liver: Nonfunctional Gene Y; Brain: Funtional Gene Y c. Liver: Functional Gene Y; Brain: Nonfunctional Gene Y d. Liver: Nonfunctional Gene Y; Brain: Nonfunctional Gene Y
Q: Sd) Even once a usable mRNA has been produced (transcribed and processed), there are still several…
A: Protein synthesis is one complex procedure taken up by the cell and that needs various components to…
Q: Describe what a core promoter in and the different types. Describe the motifs that could be found in…
A: Promoters are DNA sequence required to turn off gene or turn on gene. Promoters are of three types-…
Q: a) Design an mRNA sequence that would be translated by this system as a polypeptide consisting of…
A: RNA (Ribonucleic acid) polymerase is the major enzyme responsible for the transcription process in…
Q: In moelcular genetics, initiation is often accomplished using proteins that prevent elongation.…
A: Initiation of a process in genetics is an important event. At this stage, cell prepare itself for…
Q: Write a hypothetical sequence of bases that might be found in the first 20 nucleotides of a promoter…
A: The promoter is a DNA sequence that initiates transcription along with certain proteins. The…
Q: How would transcription of the E. coli trp operon be affected by the following manip ulations of the…
A: Transcription is the way toward making a RNA duplicate of a quality grouping. This duplicate, called…
Q: a) Initiation of transcription in prokaryotes occurs at very specific sequences called promoters.…
A: Transcription in prokaryotes requires the DNA double helix to partially unwind in the region of RNA…
Q: Many types of breast cancer have chromosomal translocation mutations. What scenario best describes,…
A: *Translocation is one type of chromosomal abnormality which chromosome breaks and it's portion will…
Q: elomere position effect (TPE) alters the gene expression in yeast cells? why?
A: Transcription and replication of adjacent DNA is affected by telomere.telomeres also impose an edge…
Q: 3. You have assembled a very short contig below, but you don’t know if this is the sense or…
A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…
Q: 2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation…
A: DNA(deoxyribonucleic acid) is the genetic material in all the organisms except few viruses. The…
Q: expression. List two types of mutations that can explain this phenotype. Justify each of the…
A: Mutation means altering the nucleotide sequence of the genome in a living organism or virus or DNA.…
Q: Yes or no? is siRNA result of activity of argonaut? Does RNAi result permanently heritable in…
A: Yes, Argonaute proteins are the active part of RNA-induced silencing complex, cleaving the target…
Q: Codon optimization is a widely used process for recombinant expression in prokaryotic systems.…
A: The codon is comprised of three nucleotides or triplets of bases. A nucleotide refers to a molecule…
Q: computer algoritnm ose kinase is a highly conserved gene that is expressed by many species, both…
A: Hybridization is the process of combining two complementary single-stranded DNA or RNA molecules and…
Q: Histone methylation can have many different effects on gene expression. In some cases, histone…
A: Expression of gene is highly under control by various mechanisms such as histone modification which…
Q: Post-transcriptional modifications in eukaryotic RNAS A. addition of CCA at the 5'end of the TRNA…
A: Post transcriptional modification is a process in eukaryotic cells by which newly synthesis RNA…
Q: . You are studying proteins having roles in translation inthe mouse. By BLAST analysis of the…
A: Phenotypes : It is an individual's observable traits, such as height, eye color, and blood type. The…
Q: 1) Histone methylation can have many different effects on gene expression. In some cases, histone…
A: According to our guidelines, we are allowed to answer a single question at a time so if you want to…
Q: (a) Write a possible sequence for an mRNA segment coding for apamine.(b) Do you think apamine is…
A: Introduction: mRNA synthesizes from the copies of DNA by the process known as transcription.
Q: E32. In the technique of DNase I footprinting, the binding of a protein to a region of DNA protects…
A: This technique is used to determine the sites in the DNA where the proteins are bound. It can be…
Q: -If the first G get deleted what kind of mutation will happen? Show the change in amino acid…
A: Any Change in the genetic material, which is not caused by recombination, that leads to altered…
Q: Post-transcriptional modifications in eukaryotic RNAS A. addition of CCA at the 5'end of the RNA for…
A: Post transcriptional modification It is a biological process in eukaryotic cell where primary…
Q: Describe the mechanisms in which DNA is used to generate protein. Reflect on the key points in the…
A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…
Q: 4. A protein is found with the sequence Met-Thr-Tp-Phe-Lys-Cys-Arg-His-Pro-Gly, A mutant is found…
A: Mutations are change in the nucleotide sequence which results in abnormalities in the protein…
Q: In any experiment, controls are essential in order to determine the specific effect of changing some…
A: Controls are used in the experiment to analyze the obtained results and reach a conclusion on…
Q: The carboxy terminus of the p53 protein acts as an allosteric regulator of sequence-specific DNA…
A: General structure of p53 protein
Q: Topic: Splicing a. What is the big picture of splicing and what is the importance of this concept…
A: RNA splicing is a process that cuts the, non-coding sequences of genes (introns) from pre-mRNA and…
Q: Alignment of protein sequences from the HOX gene family identifies a highly conserved domain in the…
A: Introduction: Hox gene actually identifies the position of any specific structure. It stands…
Q: (d) Let's suppose (I'm not saying they are; you figured that out in the question above) that the…
A: The eukaryotic genes are interrupted. The pre-mRNA contains exons and introns. The introns are…
Q: Define `transcriptome'. Briefly describe the genome tiling array technology to `visualize'…
A: Hi dear, here's your answer what you want.can you please give me a like for this answer. * Every one…
Q: Which statements are true? Explain why or why not.1 In terms of the way it interacts with DNA,…
A: Deoxyribonucleic acid (DNA) is an organic chemical that contains genetic information for protein…
Q: A. If a nascent mRNA is composed of 540 nucleotide bases and its introns (2/3 of the total number of…
A: .If m-RNA is composed of 540 nucleotides and 2/3 introns are removed during RNA splicing then we…
Q: b) How does accuracy of aminoacylation during tRNA charging regulated to ensure fidelity of genetic…
A: Answer. The fidelity of protein synthesis depends on the accuracy of the two mechanisms: The linking…
Q: 1. Histone methylation can have many different effects on gene expression. In some cases, histone…
A: As per the honor code, we only answer one question at a time; therefore, we are answering the first…
Q: Describe the path a cell surface receptor will take when being synthesized (starting at the…
A: Cell surface receptors are receptors that are located on the plasma membranes of cells. They…
Q: Gene expression in mammals can be increased by which of the following mechanisms? A. X-chromosome…
A: Gene expression The gene expression can be enhanced by activators. The activators increase the…
Q: low pH. Trying to understand how this is controlled, you look for mutants that disrupt the…
A: These are called jumping genes or transposons. These are actually DNA sequences capable of moving…
Q: INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS…
A: The process of mRNA synthesis by using DNA as a template strand is called transcription. The process…
Q: Post-transcriptional modifications in eukaryotic RNAS A. addition of CCA at the 5'end of the TRNA…
A: Answer :- Option (D) is correct. - Addition of CCA at the 5'end of the tRNA for binding with amino…
Q: Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered…
A: In the given diagram of splice donor site and acceptor site: - Splicing take place when a group of…
Q: 5' - ATGGCGAGGCGGCAGCTGTTATGGTGA – 3' In the sequence above, suppose that the 20th nucleotide of the…
A: The mRNA is produced from the template strand that is oriented in 3' to 5' direction and the newly…
Q: Describe missense and nonsense mutations and how they are different from frameshift mutations.
A: Mutations can be defined as changes in the DNA sequence. It can result from errors in replication or…
Q: Explain the process of transcription in eukaryotic systems by considering the CDK9 gene (search more…
A: Eukaryotic transcription is the complex mechanism by which eukaryotic cells copy genetic information…
Q: DNA supercoiling, which occurs when coiling tension is generated ahead of the replication fork, is…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: a) What is a mutation in molecular terms? b) a mutation deletes a base in the genomic DNA…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Flowering Locus C (FLC) is a gene that is responsible for flowering in certain plants. FLC is…
A: Acetylation of histones is known to increase the expression of genes through transcription…
Q: 7. If you have aligned orthologous gene sequences from an important, conserved gene; there is a…
A: When two species diverge into two separate species, the copies of a single gene in the two resulting…
Q: RNA knockdown has become a powerful tool in the arsenal of methods used to repress gene expression.…
A: "ANSWER A gene knockdown Is a temporary reduction in expression of genes induced by an analytical…
Step by step
Solved in 2 steps
- Yes or no? is siRNA result of activity of argonaut? Does RNAi result permanently heritable in expression of genes? Does northern blotting use to detect the expression of a transcription in multiple tissues?Protein expression: Given that we control the composition of the medium in which we grow our bacteria, are there any additional advantages of recombinant expression of proteins compared to using chemical synthesis?-If the first G get deleted what kind of mutation will happen? Show the change in amino acid sequence. deletion lead to change in reading frame (triplet grouping) of the mRNA, so that nucleotides are grouped into different codons, lead to significant changes in amino acid sequence downstream of the mutation. TACCTA-CACACATGTAGGTGGGCAAAGTT -Multiple mechanisms regulate gene expression in eukaryotes. What are the mechanisms that control the gene expression in nucleus and what are the mechanisms that control the gene expression in cytoplasm. (names not definitions)
- 1) Histone methylation can have many different effects on gene expression. In some cases, histone methylation is associated with activation of transcription, whereas in other cases it can trigger the formation of heterochromatin and a decrease in transcription. If histone methylation has been detected in the region of gene YFG in yeast, describe an experiment that could distinguish whether the methylation is important to activate or repress transcription of gene YFG. 2) An E. coli strain of chromosomal genotype lacI lacP lacO lacZ lacY . You wish to transform this strain into a wild-type lac operon by the addition of an extra piece of DNA (plasmid). What regulatory region(s), gene or genes would you add on this extra DNA that would make this strain express the lac operon genes as wild type? How would you design this plasmid if you want the strain of E. coli to express the lac operon genes even if lactose is absent in the medium (constitutively)?Transcription AttenuationHow would transcriptionof the E. coli trp operon be affected by the following manipulations of the leader region of the trp mRNA?(a) Increasing the distance (number of bases) betweenthe leader peptide gene and sequence 2(b) Increasing the distance between sequences 2 and 3(c) Removing sequence 4(d) Changing the two Trp codons in the leader peptidegene to His codons(e) Eliminating the ribosome-binding site for the genethat encodes the leader peptide(f) Changing several nucleotides in sequence 3 so thatit can base-pair with sequence 4 but not with sequence 2Alternative Splicing Possibilities Suppose exon 17 were deleted from the fast skeletal muscle troponin T gene (Figure 29.46). How many different mRNAs could now be generated by alternative splicing? Suppose that exon 7 in a wild-type troponin T gene were duplicated. How many different mRNAs might be generated from a transcript of this new gene by alternative splicing?
- RNA transcription reach low error rate under non-equilibrium steady state, what is the energy source to drive transcription ?HELP PLEASE !! In moelcular genetics, initiation is often accomplished using proteins that prevent elongation. Name and describe 3 processes where this happens, they can be in different species. Make sure to name or describe the proteins and substrates involved and how the elongation inhibition is overcome.2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation 5'TAA3' (which will be transcribed into 5'UAA3' in the mRNA - but recall that mutations are changes in the DNA sequence). Name all the amino acids that could have been coded for by the original, unmutated codon at that position in the gene.
- Transcriptional regulation You are interested in studying the transcriptional regulation of Glp1 promoter. This gene contains a binding site for two proteins A and B. Proteins A and B cannot bind to the DNA at the same time due to steric interference caused by a slight overlap in their binding sites. The binding sites of protein A and protein B can be seen in the figure below. Protein A binds to Site C and Protein B binds to site D. To assess whether either A or B have an influence on Glp1 expression, you create mutations in the DNA that selectively remove the non-overlapping sequences of binding site C or binding site D. You then examine Glp1 mRNA production within adult liver cells. You receive the following data. Experiment number Binding site C Binding site D Glp1 mRNA levels 1 + + high 2 + - high 3 - + none 4 - - none += binding site present, -= binding site absent What does this data tell us about which protein is…Please help with all parts of A, B, C, D 2. You are studying the function of a messenger RNA named Genetixrox and want to label themRNA with a radioactive atom. Assume the mRNA is long and contains all four standardRNA bases. Assume that the cell cannot convert ribonucleotides to deoxyribonucleotides (orvice versa).A. Will you generate radioactive Genetixrox mRNA with 3H-threonine? Threonine is an aminoacid. Answer yes or no, and provide a one sentence rationale.B. Will you generate radioactive Genetixrox mRNA with 3H-adenosine triphosphate? Answeryes or no, and provide a one sentence rationale.C. Will you generate radioactive Genetixrox mRNA with 3H-deoxyadenosine triphosphate?Answer yes or no, and provide a one sentence rationale.D. Will you generate radioactive Genetixrox mRNA 12C-with adenosine triphosphate? Answeryes or no, and provide a one sentence rationaleRNA knockdown has become a powerful tool in the arsenal of methods used to repress gene expression. Briefly describe how gene expression can be knocked down. What effect would introducing siRNAs to TSC1 have on human cells?