Q: The steady state level of a mRNA for a gene is affected by the following mechanism(s)
A: Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that is linked to genetic…
Q: Translating the unmutated MRNA that was obtained after splicing, the original protein sequence will…
A:
Q: Describe the various post-transcriptional and post-translational modifications that occur during the…
A: Post-transcriptional modifications are those modifications that occur after the completion of…
Q: Define . Nonsense codon as they apply to the genetic code
A: Codons are the triplet of nucleotides present in DNA (deoxyribonucleic acid) or RNA (ribonucleic…
Q: Name four major classes of DNA-binding proteins that are responsible for controlling transcription,…
A: Replication protein A Transcription factor TAL effectors Zinc finger
Q: Draw a general structure of a mature mRNA
A: mRNA is a single-stranded RNA that contains a genetic sequence and it encodes for a protein. It is…
Q: Define degenerate code.
A: A codon is a three-nucleotide DNA or RNA sequence that codes for a particular amino acid. The…
Q: Describe the strange nature of highly repetitive sequences and their function.
A: Introduction : Mammalian genomes have two major types of highly repetitive sequences: interspersed…
Q: Define Capping protein
A: Capping protein is a protein complex and it binds in a calcium-independent manner to the first…
Q: Transcriplioh nie For cuch of the following sequences, fill in either the DNA, the mRNA sequence,…
A: Synthesis of m RNA Sandhya and RNA transcription and synthesis of amino acids linked together by…
Q: Define recognition sequence.
A: A restriction enzyme or restriction endonuclease is a protein, which can recognize a particular…
Q: recognition of the AUG initiation codon in an mRNA is TRUE?
A: In eukaryotes and Archaea, the start codon always codes for methionine, while in bacteria,…
Q: Define messenger ribonucleic acid (mRNA)
A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…
Q: Identify the conditions that account for the differentseasons
A: The period of a year that is characterized from others by some characteristic climatic conditions…
Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…
A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…
Q: Define FOUR (4) types of point mutations within coding sequences
A: Coding sequences are the sequence of nucleotides in DNA capable to produce a protein. Many mutations…
Q: Give examples of the major structural motifs in DNA-binding proteins, and explain how they bind.
A: DNA binding proteins such as transcription factors recognize and bind a short nucleotide sequence,…
Q: Ôn the space provided, type the translation product of wild-type gene A (use three- letter…
A:
Q: . If tRNA is the adaptor for translation, what is theribosome?
A: Translation refers to the process of protein synthesis in the cells. The process of translation…
Q: Explain how tRNA is activated, including the role of a specifictRNA activating enzyme, ATP and amino…
A: The different types of tRNA is identified by a specific TRNA activating enzyme. The molecule of tRNA…
Q: mutant appear on a gel in comparison
A: Point mutations can cause serious changes to an organism if they change the way a protein works By…
Q: ummarize the steps involved in charging tRNAs with their appropriate amino acids.
A: The steps involved in charging tRNAs with their appropriate amino acids are as follows - Step 1:…
Q: Consider à ollowing sequence: His-Cys-Leu-lle-Met where Met is at the C-terminus end. Based on the…
A: Amino Acids are are structures linked by Peptide Bonds to Form Polypeptide Chains. Proteins are…
Q: Define a mutator or mutator gene.
A: A gene is a nucleotide sequence that specifies a certain polypeptide chain or RNA sequence, or that…
Q: translation
A:
Q: Compare prokaryotic and eukaryotic translation initiation with respect todelivering an initiator…
A: A cell is the basic structural and functional key of life. A cell has multiple organelles that carry…
Q: Write the codons for the following amino acids. 1. Phe 2. Val
A: Genetic codon: - It is the 3 nucleotide sequence of DNA and RNA, all bases are involved in formation…
Q: When a gene is being transcribed, the nitrogenous base code must be made available for reading by…
A:
Q: Example for a 10 AA peptide act. of 10aa- RNA: • initiation: elongation step 1: elongation step 3:…
A: The translation is the process of conversion of mature RNA (mRNA) into proteins which is achieved by…
Q: What is the function of the anticodon of a tRNA?
A: tRNA is basically a messenger molecule that helps in decoding of mRNA and helps in the formation of…
Q: Discuss in detail the process of transcription. proper explanation and diagram
A: Ans: Transcription: The synthesis of mRNA from DNA using RNA polymerase is referred to as…
Q: Which of the following are elongation factors involved in the attachment of new aminoacyl-tRNAs?…
A: During translation protein synthesis occurs from RNA. The sequence of nucleotides in RNA act as code…
Q: A protein has the following amino acid sequence:…
A: Given: In the given question stem, sequence of amino acid is given and we have to make set of probes…
Q: What are The Effects of Mutations on Polypeptides Helped Verify the Code?
A: DNA is a molecule that is both complex and adaptable. As such, as the product of a process called…
Q: what is the difference between leader mRNA and attenuator sequence? Please explain the function of…
A: Operon is a genetic regulatory system found in bacteria and their viruses in which genes coding for…
Q: Summarize the steps involved in charging tRNAs with their appropriate amino acids.
A: When DNA changes into mRNA- known as Transcription, by the help of enzyme RNA polymerases. When…
Q: Define Nonoverlapping code as they apply to the genetic code
A: The set of rules that allows genetic material information to get translated into proteins is called…
Q: What sequence information about a gene is lackingin a cDNA library?
A: Genetics is the branch of biology, which deals with the study of genes, their pattern of…
Q: Which of the following are elongation factors involved in the release of free tRNAs? a.EF-G…
A: The above mentioned elongation factors are involved in the process of translation in prokaryotes.…
Q: Define Reading frame as they apply to the genetic code
A: The central dogma of life is- DNA ---> mRNA ---> Protein The process of formation of mRNA from…
Q: What would be the minimum length(approximate number of bases) of an mRNAthat coded for a protein 300…
A: To determine: To determine the required minimum length of an mRNA that is coded for a protein of 300…
Q: NA has an anticodon sequence 3′– GGU–5′. Identify the amino acid it is carrying?
A: Transfer RNA, often known as tRNA, is a tiny RNA molecule that takes role in the creation of…
Q: Describe the steps of translation initiation,elongation, and termination.
A: Introduction:- The process of forming a polypeptide chain from mRNA codons is known as translation…
Q: Describe Information Transfr Replicetion - Transcuiption Tronslation
A: Genes and genomes play an important role in information processing. The genetic material of the cell…
Q: Define Initiation codon as they apply to the genetic code
A: Initiation codon is the starting point of translation. From initiation ribosome starts protein…
Q: Define the terms codon and anticodon, and list three start and stop codons.
A: Codon and Anticodon plays an significant role in the transcription and translation of the DNA and…
Provide the type of cis acting sequence element or segments
Step by step
Solved in 3 steps
- In Rho-independent termination of transcription (does NOT need the Rho protein), why does the mRNA fall off" of the template DNA?"Question 16 options: because the polymerase pauses over an AT-rich region of DNA because a helicase protein disrupts the H-bonds in the RNA:DNA hybrid because a stem-loop in the mRNA changes the conformation of the NusA protein because a stop codon is reachedQuestion 14 A large RNA–protein complex responsible for RNA splicing is called: Question 14 options: Spliceosome Splicing complex Exon-intron processor Transcription complex Question 15 Shortly after transcriptional initiation by RNA polymerase II, a methylated nucleoside (7-methylguanosine, m7G) is added and linked by a 5′–5′ phosphodiester bond to the first 5′ nucleotide, What is this process called? Question 15 options: 3' Capping 5' Capping Polyadenylation Splicing Question 16 During polyadenylation, the RNA is cleaved at a specific site. The site is: Question 16 options: 15–30 nucleotides downstream of the AAUAAA sequence 15–30 nucleotides upstream of the AAUAAA sequence at AAUAA sequence At…Question 26 What is true for CpG Islands: Question 26 options: stretches of a few hundred base pairs of DNA where cytosines are unmethylated are not associated with genes are not found around the promoters are associated with silenced genes Question 27 Depurination is a type of: Question 27 options: Oxidative DNA damage Hydrolytic DNA damage Aberrant DNA methylation Aberrant DNA acetylation Question 28 Methylation of DNA is normally a repressive signal Question 28 options: True False
- A scientist discovers a virus encoding a Protein X that degrades a subunit of the elF4F complex. Knowing that this virus transcribes its own mRNAs in the cytoplasm of human cells, why would Protein X be an effective virulence factor?New drugs are being developed that decrease DNA methylation and prevent the removal of acetyl groups from histone proteins. Explain how these drugs could affect gene expression to help kill tumor cells.Choose the combination of answers that most accurately completes the statement.Which of the following sequences, when combined with its complement, would be clipped by a restriction endonuclease? a. ATCGATCGTAGCTA c. GAATTC b. AAGCTTCGAA d. ACCATTGGA
- Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′How are introns recognized by snRNPs?Question 17 options: CTD of RNA polymerase II binds to cis-elements in the introns proteins bind to the major groove base-pairing between snRNAs and cis-elements in the intronsIn E. coli, the DNA helicase is loaded onto the DNA by __________ and activated when __________ binds the helicase. Question 24 options: DnaC; DnaG DnaA; DnaB DnaG; DnaC DnaB; DnaA DnaC; DnaB
- Question 9 Both conservative and replicative transposition result in movement of the transposon; however, only conservative transcription Group of answer choices A. Transfers the transposition to the new location without copying it B. Has transposase that cuts at inverted repeats and target sequences C. Produces a second copy of the transposon sequence D. Inserts the transposon sequence into target sequencesWhich of the following are the enzymes involved in post-transcriptional modification? Question 50 options: RNA polymerase and spliceosomes none of the options are correct RNA polymerase and poly-A polymerase RNA polymerase, poly-A polymerase, and spliceosomes poly-A polymerase and spliceosomesBelow is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?