Reagents Sterile ddH₂0 10X PCR Buffer (E) mM MgCl₂ 10mM dNTP (1) mM Forward Primer 50 mM Reverse Primer Taq DNA polymerase DNA template Final Concentration (D) X 2mM (G) UM 0.5 mM 0.5 mM Volume (UL) Per 25ul Reaction (B) 2.5 1.0 0.5 0.25 (J) 0.2 2.0 Volume (ul) for (A)X reactions (C) 22.5 (F) (H) 2.25 2.25 (K) --

Reagents Sterile ddH₂0 10X PCR Buffer (E) mM MgCl₂ 10mM dNTP (1) mM Forward Primer 50 mM Reverse Primer Taq DNA polymerase DNA template Final Concentration (D) X 2mM (G) UM 0.5 mM 0.5 mM Volume (UL) Per 25ul Reaction (B) 2.5 1.0 0.5 0.25 (J) 0.2 2.0 Volume (ul) for (A)X reactions (C) 22.5 (F) (H) 2.25 2.25 (K) --

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

You have added 4 μl of a 5 μM stock primer to a 25 μl PCR reaction. What is the amountof primer in nanomol that you have added to the reaction?
You Purified plasmid DNA (a 6.0 kb vector) and got the following results... DNA conc: 200 ng/µL A260/280: 1.97 A260/230: 2.15 How would you to set up a ligation reaction with 50 ng of digested DNA and a 1254 base pair PCR insert present at a concentration of 23 ng/µL. How should you pipet the necessary nucleotide components (vector and PCR insert) to obtain a 1:5 vector to insert molar ratio? Keep in mind limitations of pipets when giving your answer.(e.g. Pipetes won't go below 0.5µL)
You have a very concentrated sample of DNA which you need to dilute for sequencing 1:6000 with a final volume of 10 μl. How would you do this in four steps, using a serial dilution? Do not pipet less than 1 ul and do not make more than 10 ul per dilution. Describe how to do each dilution using the format suggested below.
Shown below are several next-generation sequencing reads from a sample you have. Which of the following is the most likely candidate for the original linear piece of DNA present in the sample that created the sequence reads shown below? 5' GGGCATTA 3' 5' TACGAACA 3' 5' ATACCGGGC 3' 5' ACCGTACG 3' 5' AACATACC 3' Question 4 options: 5' ATTAACCGTACGAACATACCGGGC 3' 5' GGGCATTATACGAACAATACCGGGC 3' 5' ACCGGGCATTAACCGTACGAACAT 3' 5' AACATACCGGGCATTAACCGTACG 3' 5' GGCATTAACCGTACGAACATACCG 3' 5' ACCGTACGAACATACCGGGCATTA 3'
Match the PCR sample with the predicted result on the agarose gel. 1) Sample from individual homozygous for their PV92 locus with the Alu insert. Five bands of 100, 200 500, 700 and 1000bp Single band of 300 bp Two bands one of 300 bp and one of 641bp Tow bands one of 641 bp and one of 941 bp No Bends Single band of 941 bp Single band of 641bp 2) Sample from individual homozygous for their PV92 locus without the Alu insert. Five bands of 100, 200 500, 700 and 1000bp Single band of 300 bp Two bands one of 300 bp and one of 641bp Tow bands one of 641 bp and one of 941 bp No Bends Single band of 941 bp Single band of 641bp 3) Sample from individual heterozygous for their PV92 locus having the Alu insert. Five bands of 100, 200 500, 700 and 1000bp Single band of 300 bp Two bands one of 300 bp and one of 641bp Tow bands one of 641 bp and one of 941 bp No Bends Single band of 941 bp Single band of 641bp 4) Negative control sample. Five bands of 100, 200 500, 700 and 1000bp…
You are given a tube containing 275 ng of purified PCR product (DNA) that is 1262 bp long. How many picomoles of PCR product are in the tube? The average molecular weight of a deoxynucleotide monophosphate is 328 g/mol.
consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. if the given DNA sample was subjected to ion-torrent sequencing, sketch the expected profile of the sequencing output. assume that the sequential flooding of nucleotides follows the order G-C-A-T.
Compute for the appropriate amount (mL_) of the compositions of a CTAB NaCl solution for DNA extraction. a. 10% (w/v) CTAB b. 0.7 M NaCl
The final amount of each primer required in a PCR reaction is 25 picomol. If the total volume of the PCR reaction is equal to 100 µl and the stock concentration of each primer is equal to 0.0025 mM. Calculate the volume of stock primer that needs to be added in order to ensure a primer amount of 25 picomol.
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
Calculate the volume (in µL) of DNA template required to add 60.0 ng to a 20.0 µL PCR if the DNA template is at a concentration of 19.0 ng µL-1.
We usually think of enzymes as being most active at around 37°C, yet in PCR the DNA polymerase is subjected to multiple exposures of relatively high temperatures and seems to function appropriately at 65–75°C. What is special about the DNA polymerase typically used in PCR?