Suppose that you used reverse transcriptase to copy the ovalbumin mRNA and cloned this complementary DNA (CDNA) into a plasmid vector. Would you expect this CDNA to reanneal more slowly, more rapidly, or at the same rate as genomic DNA? Briefly explain your answer. Match the words in the left column to the appropriate blanks in the sentences on the right. Reset Help less The genomic DNA would renature cDNA because it has at the same rate as complexity among the 300-bp fragments used for the analysis. greater more slowly than more rapidly than the same

Suppose that you used reverse transcriptase to copy the ovalbumin mRNA and cloned this complementary DNA (CDNA) into a plasmid vector. Would you expect this CDNA to reanneal more slowly, more rapidly, or at the same rate as genomic DNA? Briefly explain your answer. Match the words in the left column to the appropriate blanks in the sentences on the right. Reset Help less The genomic DNA would renature cDNA because it has at the same rate as complexity among the 300-bp fragments used for the analysis. greater more slowly than more rapidly than the same

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 1CT

See similar textbooks

Similar questions

Consider a partial restriction digestion, in which genomic DNA is exposed to a small, limiting amount ofa restriction enzyme for a very short period of time.a. Would the resultant fragments be longer or shorteror the same size as those produced by a completedigestion?b. If you prepared genomic DNA from a tissue sample containing millions of cells, would the fragments produced by partial digestion of DNA fromall of these cells be the same or different?
Cloning Genes Is a Multistep Process In cloning human DNA, why is it necessary to insert the DNA into a vector such as a bacterial plasmid?
. For Figure 15-7, draw out a series of steps that could explain the origin of this large plasmid containing manytransposable elements.
Assume that there are horizontal gene transfers between two completely different bacterial species. In one case it is a plasmid that is transmitted via conjugation, in the other case it is it is a part of the bacterial chromosome that is transferred via transformation. In which of the two cases is it likely that the transferred DNA will be present? left and can function in the recipient cells? Explain the biological background to your answer
Is it possible that two different restriction enzymes couldcut the human genome into exactly the same number offragments and with exactly the same distribution of fragment sizes, yet the ends produced by the two enzymescould not be joined together by DNA ligase? Explain
Genes encoding toxins are often located on plasmids.A recent outbreak has just occurred in which a bacterium that is usually nonpathogenic is producing atoxin. Plasmid DNA can be isolated from this newlypathogenic bacterial strain and separated from thechromosomal DNA. To establish whether the plasmidDNA contains a gene encoding the toxin, you coulddetermine the sequence of the entire plasmid andsearch for a sequence that looks like other toxin genespreviously identified. An easier way exists to determine whether the plasmid DNA carries the gene(s)for the toxin; this strategy does not involve DNAsequence analysis. Describe this easier method.
As you know, restriction enzymes evolved in different bacterial species independently. The adaptive significance of having a restriction enzyme is that the bacterium has the ability to cut the injected viral DNA into small segments. This destruction of viral DNA prevents the virus from taking over the bacterial cell and killing the cell. What is one benefit of using a restriction enzyme with staggered ends (such as EcoRI) to cut both the DNA insert and the plasmid? Which types of cut sites (staggered with “sticky ends” or blunt ends) are most useful in cloning DNA? Would you expect restriction enzymes in different bacteria genera (Streptococcus, Lactobacter, Escherichia) to have the same recognition sites (DNA sequences). Why or why not?
Consider the ends of the DNA fragments shown below. They have been produced by digestion of a single sequence of DNA using a number of restriction endonucleases. 1. 5'A 3' 3'TTCGA5' 2. 5'G 3' 3'CAGCT5' 3. 5'AATTC3' 3' G5 4. 5'TCGAC3' 3' G5' 5. 5'GGG 3' 3'CCC 5' Which of these ends are capable of annealing and being joined by DNA ligase?
Ehat primer sets could be amplify the following DNA sequence? AATACGTCGCATGGggatccttttttatgcatg
You are working with a recA- strain of E. coli (cannot produce functional RecA, nor carry out homologous recombination). In which horizontal gene transfer process(es) could cells of this strain successfully undergo genetic change? In conjugation, as a recipient of a portion of chromosomal DNA from a Hfr donor. In conjugation, as a recipient of a plasmid from a F+ donor. In natural transformation, as a recipient of a portion of chromosomal DNA. There are no HGT processes that could result in genetic change of this strain. In generalized transduction, as a recipient of a portion of chromosomal DNA.
In order to construct a genome library, which statement most accurately describes the correct order of steps in the process? Fragment chromosomal DNA, digest plasmid vector, ligate genomic DNA and digested plasmid vector, transform ligation into bacteria, select for plasmid marker Fragment chromosomal DNA and plasmid vector, ligate genomic DNA and plasmid vector, transform ligation into bacteria, select for gene marker Fragment chromosomal DNA and plasmid vector, ligate genomic DNA and plasmid vector, transform ligation into bacteria, select for plasmid marker Fragment chromosomal DNA, ligate genomic DNA and plasmid vector, transform ligation into bacteria, select for plasmid marker
the one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?