Primers can sometimes bind and target the wrong gene, especially if the primers are allowed to bind to the DNA strands at a low temperature. PCR also preferentially amplify short segments of DNA. Would it be important to actually run the cDNA after the PCR on a DNA gel in order to check for a PCR product of the predicted size for the insulin gene? Why or why not?How many more genes in the plasmid (besides the insulin cDNA insert) are need to determine which bacterial cells have been transformed and to determine which transformed bacterial cells have a plasmid with the cDNA insulin insert?What is needed in the plasmid with the cDNA insert besides the gene for insulin to actually cause the bacteria to express the insulin gene and produce the insulin protein?

PCR is known as a polymerase chain reaction. This method is used to amplify the gene of interest.…

Primers can sometimes bind and target the wrong gene, especially if the primers are allowed to bind to the DNA strands at a low temperature. PCR also preferentially amplify short segments of DNA. Would it be important to actually run the cDNA after the PCR on a DNA gel in order to check for a PCR product of the predicted size for the insulin gene? Why or why not?

Primers can sometimes bind and target the wrong gene, especially if the primers are allowed to bind to the DNA strands at a low temperature. PCR also preferentially amplify short segments of DNA. Would it be important to actually run the cDNA after the PCR on a DNA gel in order to check for a PCR product of the predicted size for the insulin gene? Why or why not?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 8QP

See similar textbooks

Similar questions

Which of the following is an outcome that could be produced by the application of the biotechnology as described? A. using PCR to modify a crop plant for higher yields B. introducing a recombinant DNA plasmid into a cell to trigger RNAi C. identifying SNPs to match birth parents to an adopted child D. using RT-PCR to generate copies of a gene to be expressed for insulin production An SNP is found associated with individuals who have diabetes. Which statement is true? A. All individuals with the SNP will have diabetes. B. The SNP codes for a faulty protein that causes the individual to have diabetes. C. To identify the SNP in more individuals, they will need to have their genome sequenced. D. The SNP may be linked to a gene that contributes to diabetes.
Would it be important to actually run the cDNA after the PCR on a DNA gel in order to check for a PCR product of the predicted size for the insulin gene? Why or why not?
Which of the following is necessary for a PCR reaction to proceed? a) the sequence of the ends of the DNA to be amplified must be known. b) the sequence of restriction endonuclease recognition sites in the DNA to be amplified and in the plasmid, where the amplified DNA fragment will be cloned must be known. c) The complete sequence of the DNA to be amplified must be known. d) The sequence of restriction endonuclease recognition sites in the DNA to be amplified must be known
If you knew the mRNA sequence for the human insulin gene could you know what size cDNA fragment you would find on your DNA gel when you ran it against a size standard (a “molecular ruler”)? Would you continue with your insulin cloning experiment, if the DNA from your PCR was very different in size from that predicted by the insulin mRNA? Why or why not? Primers can sometimes bind and target the wrong gene, especially if the primers are allowed to bind to the DNA strands at a low temperature. PCR also preferentially amplify short segments of DNA. Would it be important to actually run the cDNA after the PCR on a DNA gel in order to check for a PCR product of the predicted size for the insulin gene? Why or why not?
PCR errors during library amplification are one possible source of false positive results. If an error occurs in the first round of amplification, all the subsequent copies of that library fragment will also carry the variant, even though it is not present in the genome. However, reads from other library fragments spanning this same region will not have the variant, which means that identifying PCR copies, or clones, of library fragments during analysis can help to identify these types of errors. Based on what you know about PCR, which of the following statements would be true about the PCR clones in a sequencing library? A. PCR is subject to amplification bias, so reads derived from PCR clones will only map to regions that are not GC-rich. B. PCR is subject to amplification bias, so reads derived from PCR clones will only map to non-repetitive regions. C. PCR produces identical copies, so reads derived from PCR clones would map to the exact same location. D. PCR introduces many…
Why is it important to sequence positive clones derived from PCR cloning? Group of answer choices Errors could have been incorporated during restriction enzyme digestion and so it is important to verify that only the expected protein is produced. Errors could have been incorporated during plasmid DNA extraction and so it is important to verify that only the expected protein is produced. Errors could have been incorporated during PCR and so it is important to verify that only the expected protein is produced. Errors could have been incorporated during cloning and so it is important to verify that only the expected protein is produced.
Which of the following describes an advantage of using a recombinant plasmid for DNA cloning over PCR? A. PCR is more likely to have errors introduced in the copying process. B. Recombinant DNA plasmids are able to create large amounts of copies more quickly than PCR. C. PCR can only be conducted in eukaryotic cells. D. PCR requires prior knowledge of the sequence in question, while a recombinant plasmid does not.
The answer is option A In the PCR amplification, two primers are used to flank the target region to amplification. The two primers are forward primer and reverse primer. The forward primer binds to the template DNA and the reverse primer binds to the complementary strand. Step 2 In the above question, the two sequences of 21bp primers in the 5' to 3' Orientation that allows amplifying the given gene sequence are : ATGTTTGTTTTTCTTGTTTTA and GTCAAATTACATTACACATAA CAN YOU FURTHER EXPLAIN WHY IT IS "GTCAAATTACATTACACATAA," I don't understand why it's called reverse primer? and where exactly it is binding to on the strand? (A picture would really help)
You wish to amplify a segment of DNA from a plasmid template by PCR with the use of the following primers: 5’-GGATCGATGCTCGCGA3' and 5' -AGGATCGGGTCGCGAG-3'. Despite repeated attempts, you fail to observe a PCR product of the expected length after electrophoresis on an agarose gel. Instead, you observe a bright smear on the gel with an approximate length of 25 to 30 base pairs. Explain these results.
What is expected theoretical number of copies of DNA molecules after 28 cycles in a PCR experiment? What is the percent efficiency of the PCR experiment if the actual number of copies was 500,000,000? Show your calculations
As you know, restriction enzymes evolved in different bacterial species independently. The adaptive significance of having a restriction enzyme is that the bacterium has the ability to cut the injected viral DNA into small segments. This destruction of viral DNA prevents the virus from taking over the bacterial cell and killing the cell. What is one benefit of using a restriction enzyme with staggered ends (such as EcoRI) to cut both the DNA insert and the plasmid? Which types of cut sites (staggered with “sticky ends” or blunt ends) are most useful in cloning DNA? Would you expect restriction enzymes in different bacteria genera (Streptococcus, Lactobacter, Escherichia) to have the same recognition sites (DNA sequences). Why or why not?
The temperature at which the primers and target DNA hybridize may be changed to influence the stringency of PCR amplification. What effect will changing the hybridization temperature have on the amplification? Let's say you have a certain yeast gene A and want to check whether it has a human equivalent. How might managing the hybridization's rigor benefit you?