The figure below represents two DNA molecules, with polarities as indicated. The dashed block shows the region of DNA which you wish to amplify by PCR. In each case, indicate the positions of the forward and reverse primers you would use for the PCR, their polarities, and the direction of synthesis of the new strands with an arrow at the end of the primer. 5' 3' ------------------- 3' 3' 5' 5' ------------------------------ 5' 3'
Q: The traditional organization of the animal family tree of classification is based mostly on a. DNA…
A: Animal categorization into a family tree, or phylogeny, is based on comparable characteristics of…
Q: Let's suppose that a normal chromosome carries genes labeled A through /. The centromere is located…
A: A. Ignoring fertility issues, the individual with the inverted chromosome will likely be…
Q: which of the following models represents the genetic material that controls inherited traits
A: The DNA model is the model that represents the genetic material responsible for inheriting traits.…
Q: DNA molecule, which embodies genes, the hereditary units, is found in all living things. Science…
A: The steps involved in the production of human insulin in bacteria using biotechnology are : 1.…
Q: please answer all if possible i need it badly and asap make sure its correct
A: Which structure produces secretions that regulate blood sugar?Correct answer: c. FRationale:…
Q: Consider the following two nonhomologous wildtype chromosomes, where letters or numbers represent…
A: AThe rearrangement in scenario A is a tandem duplication, where the duplicated segment GH is…
Q: Why two strands of DNA are synthesized differently
A: Certainly! Let's break it down further.1. DNA Structure and Complementary Base Pairing:DNA, the…
Q: Which of the two benefits listed are both a "cultural service" as well as an "existence value"? Drag…
A: Let's identify the benefits that align with both "cultural services" and "existence value." These…
Q: 29) The doubling time in the bacterial growth cycle is measured during: a) Prodromal period b) Log…
A: 29 Measuring doubling time during the log phase of bacterial growth:The doubling time of bacteria is…
Q: Who discovered Bacterial small noncoding RNAs (sRNAs) ?
A: Bacterial small noncoding RNAs (sRNAs) are a differing class of RNA particles found inside bacteria…
Q: What is photosynthesis?
A: Photosynthesis is a biological process that occurs in green plants, algae, and some bacteria. It is…
Q: RELPs: A. are the same length for mutant and normal beta-globin alleles. b. determine the sequence…
A: Approach to solving the question: Read through each statement carefully and determine which ones…
Q: What part of a avocado plant is consumed by humans ? leaves? Roots? Stem?
A: 1. Avocado Tree Growth: Avocado plants start as seeds. Once planted, they grow into trees. It takes…
Q: Describe the formation and filling of soft gelatin capsule
A: Soft gelatin capsules are a commonly used oral dosage form in the pharmaceutical industry. These…
Q: What is the source of genetic variation in a population? Natural selection Mutation and sexual…
A: The question is asking about the sources of genetic variation in a population. Genetic variation is…
Q: The cytoplasmic granule of RNA and protein that reads the message in mRNA is a/an____________ .
A: In cells, different parts have specific jobs in making and controlling proteins. One important part…
Q: ons: On They will select and present a label for a pet food. They will identify on the label each of…
A: 1. **Main Display Panel** - This is typically the front of the package and includes the brand and…
Q: 2. The following questions refer to the pedigree chart in the figure for a family, some of whose…
A: To answer these genetic questions, I'll break down each scenario, analyze the pedigree charts, and…
Q: Can a DNA test tell you where someone is from and "who" (which ethnic group) they are from? Why or…
A: DNA tests have revolutionized our understanding of ancestry and ethnicity. These tests analyze an…
Q: QUESTION 5 For each of the following epigenetic modifications, describle how it affects…
A: Histone Acetylation:Effect on Transcription: Increases transcriptionMechanism: Histone acetylation…
Q: Please answer both thank you!
A: 11)Answer:Centrifuges are workhorses in blood analysis, utilizing the principles of circular motion…
Q: Which of the following would tend to DECREASE uptake of water by a plant root hair? Increasing the…
A: The question is asking which of the given options would decrease the uptake of water by a plant root…
Q: Contrast experimental and statistical analyses of cumulative selection in proteins.
A: Cumulative selection in proteins may be a crucial concept in molecular science that relates to how…
Q: Which of the following is not required for PCR? a. dNTPs b. bacterial plasmids c. carefully…
A: c1. DNA's building blocks are called deoxyribonucleotide triphosphates, or dNTPs. DNA polymerase…
Q: The French philosopher and mathematician Rene Descartes is credited with proposing arguments in…
A: The objective of the question is to identify which of the given ideas was not proposed by Rene…
Q: If the statement pertains to a threatened species, put an x in the threatened column. If the…
A: Detailed explanation: ThreatenedEndangered at least a few individuals are still presenta species…
Q: Describe Hemolytic Disease of the Newborn (HDN). Who is at risk for this disease? How can it be…
A: Certainly! Let's dive deeper into Hemolytic Disease of the Newborn (HDN) to understand its causes,…
Q: Define acidosis and alkalosis. Distinguish among respiratory and metabolic acidosis and alkalosis.
A: pH is the negative logarithm of H+ concentration in a solution. The pH range goes from 0 - 14. If…
Q: How has the wild version of a avocado plant been modified for human consumption ? what parts of the…
A: 1. Fruit size and shape:• The wild avocado plant naturally produces small, round to egg-shaped…
Q: The hypothetico-deductive method in science includes all of the following components except: logical…
A: The hypothetico-deductive method is a proposed description of scientific method. According to it,…
Q: Site A Site B Site A7 Species Site B = 5 Species *A*+* + Site C7 Species A Site C A vs B = 8 species…
A: the most accurate justification for saving Site C is that it contains the greatest number of unique…
Q: Evaluate the following ABG results. Determine whether the results are high, low, or normal.…
A: The objective of the question is to interpret the given Arterial Blood Gas (ABG) results and…
Q: Snuffle Snork TAC CAA AGA AAT ATT TAC ATG GGT GTT GTC TTC ACT TAC GAG GAT AGC CGC ATC TAC CAA CGA…
A: The objective of this question is to understand how DNA determines the traits of an organism. In…
Q: Which Renaissance artist and engineer produced sketches of tanks, submarines, helicopters, machine…
A: The question is asking for the name of the Renaissance artist and engineer who not only produced…
Q: When virulent bacteria invade an organism, they usually inflict damage to it. Can you assess the…
A: let's delve deeper into each of these mechanisms: Toxins Production:Exotoxins: These are proteins…
Q: Discuss why hypertension is considered the silent killer and why don't people take their high blood…
A: Why Hypertension is a Particularly Deceptive Threat: Hypertension, or high blood pressure, has…
Q: The axial skeleton can be divided into the skull, the vertebral column, and the __________.
A: The objective of the question is to identify the third major part of the axial skeleton, given that…
Q: Why are immature RBCs sometimes present in the blood? Question 7 options:…
A: The presence of immature red blood cells, also known as reticulocytes, in the blood is usually a…
Q: Imagine the unlikely case that the 11 individuals represented in the gel image above were truly…
A: Approach to solving the question: Detailed explanation:According to the numbering system given, the…
Q: Rainforest plants from which we extract medicines would be considered as a provisioning service.…
A: A provisioning service is any type of benefit to people that can be extracted from nature. Along…
Q: Which of the following statements is correct about the development of T cells? O After many cell…
A: T cells, including CD4+ T cells (T helper cells) and CD8+ T cells (cytotoxic T lymphocytes), develop…
Q: antigenic changes in viral pathogens promote disease?
A: Antigenic changes in viral pathogens are a central theme within the study of infectious illnesses,…
Q: Can u give me the correct answer
A: Solution: (information required was not provided. One possible food web is provided in the image…
Q: Why do positive feedback systems that are part of a normal physiological response include some…
A: Positive feedback loops are fundamental to physiological processes. This framework is fundamental in…
Q: Distinguish between dehydration synthesis and hydrolysis.
A: In science, numerous crucial processes include synthesizing and breaking down complex particles. Two…
Q: QUESTION 6 A series of experiments were performed in Neurospora crassa in order to define the…
A: 1. Precursor and Intermediates:The precursor molecule is the starting point of the biosynthesis…
Q: The table below shows four organisms and the biological processes each uses. Select the organisms…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: For the VWA locus, Sophie has two alleles, 16 & 18. She inherited the allele with 16 copies from…
A: Answer well explained above
Q: What is a gene
A: The objective of this question is to understand the biological concept of a gene.
Q: No need guidelines answers
A: let's take a methodical approach to dissecting the reasons for each of the genetic situations that…
Step by step
Solved in 2 steps with 1 images
- Which of the following best describes the process of DNA sequencing? a. DNA is separated on a gel, and the different bands are labeled with fluorescent nucleotides and scanned with a laser. b. A laser is used to fluorescently label the nucleotides present within the DNA, the DNA is run on a gel, and then the DNA is broken into fragments. c. Nucleotides are scanned with a laser and incorporated into the DNA that has been separated on a gel, and then the DNA is amplified with PCR. d. Fragments of DNA are produced in a reaction that labels them with any of four different fluorescent dyes, and the fragments then are run on a gel and scanned with a laser. e. DNA is broken down into its constituent nucleotides, and the nucleotides are then run on a gel and purified with a laser.You have two PCR primers: Forward- 5' TGAGCTAGGC 3' and Reverse- 5' GGTTCAGTCAG 3'. Show the binding sites of the primers to their Double strand DNA template. As the primer sizes are 10 and 11 bp, just write a 30 bp double stranded DNA (making sure the 5' and 3' ends of the double strand DNA in all 4 ends) and show where in the 30 bp double stranded DNA, these two primers would bind in correct orientation.For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’
- For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’You want to amplify the following sequence of DNA from a gene of interest that you are studying. To do this, you will use PCR. Design a forward and reverse primer. Show where the primers anneal to the template sequence. Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’ TACTGCCTTATATTCGACCACCACCACC---CCGACGTACTCGACGTTCACACACGAGAGGATT 5’ (PLEASE EXPLAIN STEP - BY STEP) Answer : Foward primer 5": Reverse primer 3"You would like to amplify the gene shown below using PCR. What is the sequence of the primer you would generate for the left side of the sequence? a) 5’ GCGGTTAA 3’ b) 5’ CGCCAATT 3’ c) 5’ TTAACCGC 3’ d) 5’ AATTGGCG 3’
- Entire sequence below needs to beamplified by PCR and subcloned into a plasmid vector. Which of the primersequences listed underneath is the correct reverse primer (6 marks)? Copy correctsequence into your answer. Why primer e) is not the right answer (4 marks)? 5'ATCTCTATTTAATATTTATGTCTATTTAAGCCTCATATTTAAAGACAGGGAAGAGCAGAACGGAGCCCCAGGCCTCTGTGTCCTTCCCTGCATTTCTGAGTTTCATTCTCCTGCCTGTAGCAGTGAGAAAAAGCTCCTGTCCTCCCATCCCCTGGACTGGGAGGTAGATAGGTAAATACCAAGTATTTATTACTATGACTGCTCCCCAGCCCTGGCTCTGCAATGGGCACTGGGATGAGCCGCTGTGAGCCCCTGGTCCTGAGGGTCCCCACCTGGGACCCTTGAGAGTATCAGGTCTCCCACGTGGGAGACAAGAAATCCCTGTTTAATATTTAAACAGCAGTGTTCCCCATCTGGGTCCTTGCACCCCTCACTCTGGCCTCAGCCGACTGCACAGCGGCCCCTGCATCCCCTTGGCTGTGAGGCCCCTGGACAAGCAGAGGTGGCCAGAGCTGGGAGGCATGGCCCTGGGGTCCCACGAATTTGCTGGGGAATCTCGTTTTTCTTCTTAAGACTTTTGGGACATGGTTTGACTCCCGAACATCACCGACGCGTCTCCTGCTG 3'a) 5' TTCCGGAAGAAGCTTATACGG 3'b) 5' CTGTGTTCACCTAATATTCCT 3'c) 5' CAGCAGGAGACGCGTCGGTGA 3'd) 5' AGGAATATTAGTATAATCCAC 3'e) 5' GACGCGTCGGTGATGTTCGGG 3’f) 5'…PCR is an exponential copying of the template strands and can be represented by the function: y = a * 2n, where a is the initial number of template copies and n is equal to the number of cycles PCR has gone through. How many DNA fragments would be produced after: 15 cycles? 13 cycles with 13 starting template strands? 29 cycles with 32 starting template strands?The sequence of a template DNA is GGGCCATTCGAACGTCCGAAAATGCCCCTGAATGAAAATTTTGGCCC. The sequence of a primer used for PCR amplification of the above DNA is CCCGGTAAGCTT. Where is the 5' end for the template and primer, respectively? answer options: 1) Left, left 2) Right, left 3) Left, right 4) Right, right 5) Right, left
- The PCR reaction contains deoxynucleotide triphosphates (dNTPs) in order to construct new DNA. There are four different dNTPs used in this reaction. Which answer below lists the four different dNTPs used in PCR? A) DNA polymerase, helicase, ligase, topoisomerase B) adenine, guanine, cytosine, thymine C) adenine, guanine,cytosine, uracil D) Alanine, guanine, cytosine, Theron oneHow would you approach this problem? You plan to sequence the following DNA by Sanger sequencing. Your reaction includes your sequencing primer (5' is on the left) and template DNA (5' end is on the left), dNTPs, buffer, DNA polymerase and the following fluorescent ddNTPs: red ddGTP, green ddATP and blue ddTTP. Sequencing Primer: CCGCCGGGCCCCAT Template to be Sequenced: GAGCGGCGGGCTGAGTAGCTCGCCGCGGGGATGGGGCCCGGCGGATTIn pcr experiment, Does electrophoresis show that only DNA products of the desired size are present? If not, what do you think is the reason?