The following diagram represents one of the Christmas-tree-like structures shown in Figure On the diagram, identify parts a through i. Q. 5′ and 3′ ends of at least one RNA molecule
Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…
A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…
Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′Make a drawing.
A: RNA stands for ribonucleic acid. It is a complex compound comprising of high molecular weight and…
Q: true or false The structure of the transfer RNA assumes a more 3-dimensional structure because of…
A: Structure of tRNA: It consists of 4 parts: Acceptor stem: It attaches the AA Anticodon loop: It…
Q: The structure of the transfer RNA assumes a more 3-dimensional structure because of the hydrogen…
A: Asked : The structure of the transfer RNA assumes a more 3-dimensional structure because of the…
Q: Tell whether the following elements are found on DNA or RNA: a. -10 region b)e. poly(A) tai c).…
A: a) -10 region is found in DNA. it is also called pribnow box and is an essential part of a promoter…
Q: Which type of RNA has the least amount of secondary structure? Explain
A: Ribonucleic acid (RNA) is considered an important biological macromolecule present in all cells to…
Q: RNA interference may be triggered when inverted repeats are transcribed into an RNA molecule that…
A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part…
Q: Three E. coli tRNA molecules with the anticodon sequences CGG, OGG , and UGG are charged with the…
A: During Protein synthesis or translation that occurs in ribosomes, messenger RNA code for an amino…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The translation is a process through which a polypeptide chain is synthesized based on the sequence…
Q: The figure represents tRNA that recognizes and binds a particular amino acid (in this instance,…
A: Your answer is incorrect and the correct answer is 5'-UUC-3' This is because the amino acid…
Q: Select the correct statement(s) about transfer RNAs. Codon recognition occurs through specific…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: Which of the following sequences is most likely to form an a helix?
A: An alpha helix is a sort of secondary structure, which describes how a protein's main chain is…
Q: The following statements best describes the RNA structure EXCEPT
A: RNA is also known as ribonucleic acid, which is present in almost all cells. It is also similar to…
Q: Sickle cell anemia occurs due to a point mutation in a gene for hemoglobin protein. This mutation…
A: Sickle cell anemia occurs due to point mutation in a gene for hemoglobin. Its symptoms are - fatigue…
Q: Label the 5' and 3' ends of DNA and RNA and the amino and carboxyl ends of the protein. Assume it is…
A: DNA is the genetic material in all the living cells.
Q: describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be…
A: Usually Central dogma of Molecular Biology is followed during the process of protein synthesis which…
Q: Does base stacking play any role in stability of RNA (single-stranded)? Explain please!
A: Introduction Deoxyribonucleic acid (DNA) is one of the important biomolecules. It is a long…
Q: A double-stranded region of RNAa. forms a helical structure.b. obeys the AU/GC rule.c. may result in…
A: The ribonucleic acid (RNA) is a high molecular weight compound that functions in the translation of…
Q: Which of the following best describes a stop codon?
A: Stop Codons constitute of three nucleotide sequence of m-RNA that doesn't code for any amino acid.…
Q: Shown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids…
A: The process of synthesis of messenger RNA with the help of template DNA strand is called…
Q: The DNA sequence of the coding strand is shown below; which reading frame most likely codes for a…
A: Start codon in translation is AUG in RNA and ATG in the DNA sequence that codes for methionine amino…
Q: The figure provided in in the introduction above shows adenine being deaminated to form the…
A: Wobble hypothesis - is about the base pairing between nitrogen bases in 1st and 2nd positions of the…
Q: RNA interference may be triggered when inverted repeats are transcribed into an RNA molecule that…
A: Ribonucleic acid (RNA) is genetic material of many bacteria and other small microorganisms. RNA…
Q: An RNA molecule has the following percentages of bases: A = 23%, U = 42%, C = 21%, and G = 14%. Q.…
A: RNA stands for ribonucleic acid which acts as a messenger in carrying instructions from DNA for…
Q: The following diagram represents one of the Christmas-tree-like structures shown in Figure On the…
A: The Christmas tree-like structure is observed under an electron microscope of the DNA undergoing…
Q: What structural features are shared by spliceosomes(Figures 8-16 and 8-17) and ribosomes? Why are…
A: Proteins are polymers of amino acids that have diverse roles.
Q: Which of the following regarding RNA secondary and tertiary structure is false? Coaxial stacking is…
A: Introduction The secondary structure of RNA is made up of stem loops and hairpins and they are…
Q: A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will…
A: During transcription process, the strand used as template is known as template strand which sets in…
Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino…
A: Transition refers to a point mutation that changes a purine nucleotide to another purine or a…
Q: Sickle cell anemia occurs due to a point mutation in a gené för changes the amino acid at position 6…
A: Red blood cells are small, round, and convex cells that transport oxygen throughout the body.…
Q: Sketch a typical cloverleaf structure for transfer RNA. Point out any similarities between the…
A: The proposed structure of ribosomal RNA comprises two ribosomal subunits, a large subunit, and a…
Q: To carry out its role, each transfer RNA requires at least four specific recognition sites that must…
A: Transfer RNA (tRNA) is formerly known as soluble RNA. They are adapter molecule that serves as a…
Q: Why is RNA structure so unstable? Explain in detail.
A: RNA is generally single stranded. RNA is a polymer of nucleotides. Nucleotides of RNA are composed…
Q: The nucleoside inosine frequently occurs as the third base in codons. What role does inosine play in…
A: Inosine is the nucleoside made up of ribose and hypoxanthine.
Q: If an RNA molecule could form a hairpin with asymmetric internal loop, as shown in Figure Q6–5,…
A: The nucleic acid is a significant macromolecule found in all living organisms. The molecule is…
Q: The images shown depict the initiation and elongation steps in protein translation. Arrange the…
A: The amount of mRNA which is define with the mechanism that is usually produced by a gene is limited,…
Q: For the case n = 5, the equilibrium constant for this reaction, Keg, is 5-10³ and for n= 6 Keg =…
A: Thermodynamics in biochemistry is the quantitative study of the change in energy which occurs in or…
Q: The genetic information contained in DNA consists of a linear sequence of coding units known as…
A: From the given case, it is known that the E. coli DNA has a size of 4.70 X 106 bps. As, it is given…
Q: Name the three forms of ribonucleic acid (RNA) and describe their structures. Discuss how these…
A: The base sequences of RNA can be determined by knowing the base sequences of DNA as the information…
Q: What are the two functional ends of transfer RNA and how do they work to accomplish these functions?…
A: Two functional ends of transfer RNA are anticodon and acceptor arm.Acceptor arm is the site where…
Q: With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the…
A: The process by which DNA gets converted into RNA molecule is called as transcription and then mRNA…
Q: The structure below shows that of a polypeptide composed of multiple amino acid residues, some of…
A: Introduction The quaternary structure refers to the amount and arrangement of the protein subunits…
Q: Draw the stem-loop structure and the homodimer structure this RNA sequence (GGCCCUUUUCAGGGCC) can…
A: Single-stranded RNA (ribonucleic acid) having regions of complementary ribonucleotides can form…
Q: Consider the wobble rules listed in Table 15.2. Which of the following mRNA codons will bind to the…
A: Protein translation is the process of molecular biology in which the mRNA synthesized by the process…
Q: Determine the sequence of amino acids specified by the codons in the following information strand.…
A:
Q: A DNA-binding protein recognizes the following…
A: BASIC INFORMATION NUCLEIC ACID The molecules which hold the ability to carry information of cells…
Q: Which of the following is likely to be found in the DNA binding domain of regulatory proteins? A…
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: The mature m-RNA is capped by which of the following heterocyclic bases (or which of the following…
A: Transcription is a process through DNA is converted into mRNA.
Q: Consider the following portion of mRNA: 3'-CUU-AAA-CGA-GUU-5' What is the primary amino acid…
A: mRNA(messenger RNA) carries the genetic information copied from DNA in the form of a series of…
The following diagram represents one of the Christmas-tree-like structures shown in Figure On the diagram, identify parts a through i.
Q. 5′ and 3′ ends of at least one RNA molecule
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- The following diagram represents one of the Christmas-tree-like structures shown in Figure On the diagram, identify parts a through i. Q. Molecules of RNA polymerase (use dots to represent these molecules)The following diagram illustrates a step in the process of translation. Identify the following elements on the diagram. a. Stop codonWhat RNA base sequence is complimentary to the following DNA base sequence 5'-CATGATTAT-3'? Using the table of codons, give the primary structure of the protein coded for by the RNA sequence: 5’-CCA CGA GGG GAG ACU UAA-3’?
- The following diagram illustrates a step in the process of translation. Identify the following elements on the diagram. a. Start codonThe following diagram illustrates a step in the process of translation. Identify the following elements on the diagram. a. 5′ and 3′ ends of the mRNAThe following diagram illustrates a step in the process of translation. Identify the following elements on the diagram. a. Approximate location of the next peptide bond that will be formed
- The following diagram illustrates a step in the process of translation. Identify the following elements on the diagram. a. Amino and carboxyl ends of the newly synthesized polypeptide chainThe following diagram illustrates a step in the process of translation. Identify the following elements on the diagram. a. Place on the ribosome where release factor 1 will bindIn the following picture, identify the type of DNA binding motif is shown and the characteristics.
- For the RNA molecule shown in Figure , write out the sequence of bases on the template and nontemplate strands of DNA from which this RNA is transcribed. Label the 5′ and 3′ ends of each strand.For the RNA sequence AUUGGCAUCCGAUAA, draw the secondary structure that maximizes its base pairing.A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′Make a drawing.