The following is not an indication of a very low BOD except? A The water is healthy thus, water quality is high. B) Contamination is present. c) The available microorganisms are uninterested in consuming the available organics. D The available microorganisms are dead or dying.

Q: QUESTION 37 A reservoir is O an environment that may contain various pathogenic microbes. O a living…

A: Introduction :- All living and non-living objects that occur naturally, or in this example, without…

Q: heightened responses to ethanol, and ken&barbie (kb) lack external genitalia. [These are real genes…

A: The technique of pinpointing a gene's position on a chromosome is known as gene mapping. The most…

Q: Which phase of the cardiac cycle has the largest influence on the Frank-Starling mechanism? systole…

A: Introduction :  The cardiac cycle is the series of events that take place throughout each heartbeat,…

Q: Answer these questions in a You may include labeled drawings or tables, if helpful. Short answers,…

A: Countless trillions of chemical reactions take place daily in our bodies to support vital metabolic…

Q: What was the purpose of adding KOH to the cotton balls in the respirometers? Consider what gases…

A: Respirometers are instruments that monitor changes in gas volume and can thus offer data regarding…

Q: List five important characteristics of epithelial tissue

A: We know that Epithelial tissues comprise thin tissues that cover the entire body's exterior…

Q: Differentiate Invitrogen pCR® II-TOPO® Vector from pBR322 Vector.

A: Molecular cloning : Production of genetically identical copies of a cell or its genetic material is…

Q: Problem: A bacteria can multiply at an alarming rate when bacterium splits into two new cells, then…

A: Bacteria divides at an alarming rate by binary fission that is one bacteria divides into two…

Q: Draw a strict consensus tree based on your tree and Tree 1. Circle all the polytomies

A: Strict consensus tree : To determine the phylogenetic relationship the strict consensus tree is one…

Q: Match each statement with the best possible single answer from the list below. Terms may be used in…

A:

Q: In Polymerase Chain Reaction (PCR), the temperature is one of the most important parameters that…

A: Note:  As per the guidelines, the first question has been solved here. Please post the other…

Q: Match each statement with the best possible single answer from the list below. Terms may be used in…

A: Addition of TTGGGG repeats Correct match for this statement are - Telomerase.   Explanation…

Q: 1) Using Punnett Squares, determine which genotypes are possible at each gene locus if you cross…

A: Mendelian inheritance describes specific patterns of how features are passed down from parents to…

Q: The same restriction digestion experiment was repeated for EcoR1 on the same DNA molecule. However,…

A: It is given that the incubation period of the restriction digestion with EcoRI on the same DNA was…

Q: roblem 1 a) State the different requirements for a disinfectants b) State the advantages and…

A: Disinfection is process of the application of a chemical agent to destroy or inhibit the growth of…

Q: Circle all inheritance patterns that you cannot rule out to explain this pedigree. Assume…

A: Answer is D Autosomal recessive

Q: A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the…

A: SYBR TAQMAN Not so costly Expensive Easy to use Difficult to use Binding the fluorescent dye…

Q: Polymerase chain reaction (PCR) is a technique that enables multiplication of specific DNA sample at…

A: The polymerase chain reaction (PCR) was hugely successful in molecular biology. PCR tests are…

Q: M D

A: The crown and the root are the two anatomical sections of a tooth. The top portion that is exposed…

Q: DNAT  A  C         C  G  C      C  C  C        A  T  G      A  T  G       A  A  T       A  C  C…

A: DNA sequencing is the process of determining the sequence of nucleic acids, which are the basic…

Q: Does Totoaba offer any ecosystem benefits? I know their demise is causing the Vaquita to go extinct…

A: Totoaba: Totoaba is a large marine fish found in the Gulf of California, is well known for its high…

Q: The schematic on the right is for which molecular biology method?             What information…

A: Please follow steps 2 & 3 for detailed explanation.

Q: Which statement about metabolic pathways is false? OA. A specific enzyme catalyzes each…

A: Metabolic pathways are set of reactions catalysing conversion of one substrate into some product.…

Q: Describe an exercise routine that would build up each of the following groups of muscles: anterior…

A: When your muscles are making energy anaerobically, lactic acid is came out as a byproduct. It build…

Q: Which of the following statements is false? a mutation in a 5' or 3' splice site must alter the…

A: When genes occasionally undergo "mutations", which alter the instructions for forming the protein,…

Q: 26. What is the start codon and the corresponding amino acid for which it codes? FIISI DAS U O O UUU…

A: Introduction  The genetic code is a set of instructions that enable live cells to produce proteins…

Q: Identify the structures and events of the sliding filament mechanism. A band H zone H zone reduced M…

A: SLIDING FILAMENT THEORY:  Sliding Filament Theory explains the mechanism behind the Contraction and…

Q: How would scientists describe the density of a population? O 47 giraffes living on the African…

A: Population density can be defined as the average number of individuals that belong to a population…

Q: Is it possible to perform DNA profiling with SNPs instead of SSRs as DNA markers, but in general you…

A: SNPs are used by geneticists as markers to find genes in DNA sequences. Suppose a gene alteration…

Q: Jackson Wang is a biologist working with the genetics of a thermophilic bacterium. He cloned a heat…

A: Gene cloning is a frequent process in molecular biology labs where researchers make clones of a…

Q: How does interobserver variation contribute to the reliability of test results?  3.2. A liver cancer…

A: Disease Epidemiology involves studying of causes of diseases, their outcomes on the health of people…

Q: 2. Circle all inheritance patterns that you cannot rule out to explain this pedigree: a. autosomal…

A: Pedigree:-   When the inheritance off particular character sticks or disease or any other health…

Q: Question 4a-d: H9 IMR90 AT ال ... DMRS Gene Chr10 a. Name one method that could have been used to…

A: DNA methylation is a heritable epigenetic mark that involves DNA methyltransferases covalently…

Q: A given substance would require active transport across a lipid bilayer into a cell if... (choose…

A:

Q: 1. Why do meristematic cells have a prominent nucleus and dense cytoplasm but they lack vacuole?

A: Plant cells with the capacity to proliferate and give rise to new cells are known as meristematic…

Q: Why is random distribution of species the least common pattern? O It eliminates the protection…

A: The distribution of members of a population over space and time is referred to as a species'…

Q: which of the following influences the bonding of oxygen to to hemoglobin?  a) pH  b) oxygen…

A: Hemoglobin molecule is the combination of a globin protein molecule and non-protein part heme and is…

Q: Living modified organism (LMO) is defined as any living organism that possesses a novel combination…

A: Living modified organism means an organism which genetic materials has been altered artificially…

Q: is energy is released when ATP loses a phosphate group true about ATP and ADP

A: ATP is the energy currency of the cell and is made up of adenine and ribose sugar with three…

Q: BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design…

A: It is required to use oligonucleotide primers while conducting a PCR reaction. Designing primers…

Q: Which phyla did you not expect to be grouped together based on their morphology? How could…

A: Introduction  Systematics is a branch of biology that deals with classifying and cataloging animals…

Q: What is the target of NK cells? What is the target of phagocytes? What is the target of Cytotoxic T…

A: Introduction :- By preventing the progression of cancers and microbial infections and the resulting…

Q: 6. Alleles A and a are present in the parental nucleus, how many are present in the gametes? (This…

A: 6. The correct answer is one. Only one of the alleles will be present in the gametes. It is given…

Q: & ameloblasts, that help create teeth. mammals develop during embryonic que

A: Using an animal model, the UAB researcher’s found that a lack of Sp7, a transcription factor,…

Q: change

A:

Q: Use the ionic current traces to explain the shape and duration of the ventricular AP shown.

A: The above figure shows the action potential and the below figure indicates the ions movements,…

Q: What is the advantage to an organism in using aerobic cellular respiration compared to the anaerobic…

A: Cellular respiration is the process by which the biological fuels are oxidised in the presence of an…

Q: All cells that have the appropriate receptor show an identical response to a given hormone. False…

A: Signal molecules secreted by endocrine glands are called hormones. These molecules may be lipophilic…

Q: other diseases like Kwashiorkor Syndrome

A: Kwashiorkor: It is a condition which results from the inadequate protein intake. Initial symptoms…

Q: On the diagram of the interneuron, drag and drop the terms dendrites, cell body, axon and synaptic…

A: The diagram in the question shows a nerve cell or neuron. The labeling will be as follows.  The top…

Physical and Chemical features

The physical property of a compound could be determined without modifying the originality of the compound. Examples of physical properties are density, hardness, color, boiling, and melting point. The chemical property expresses the ability of a compound to undergo a particular chemical change.