This is always the first step in the transcription process:The two DNA strands are partly separated from cach other by RNA polymeraseO The DNA coding strand is used to make a new template strandThe two DNA strands are completely separated and copiedThe two DNA strands are bonded together covalently

Name: This is always the first step in the transcription process:The two DN
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: This is always the first step in the transcription process:The two DNA strands are partly separated from cach other by RNA polymeraseO The DNA coding strand is used to make a new template strandThe two DNA strands are completely separated and copied

Transcription refers to the production of RNA from DNA. From the gene sequence of DNA, a…

Science

Biochemistry

This is always the first step in the transcription process: O The two DNA strands are partly separated from each other by RNA polymerase The DNA coding strand is used to make a new template strand The two DNA strands are completely separated and copied The two DNA strands are bonded together covalently

This is always the first step in the transcription process: O The two DNA strands are partly separated from each other by RNA polymerase The DNA coding strand is used to make a new template strand The two DNA strands are completely separated and copied The two DNA strands are bonded together covalently

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 8QP: The following segment of DNA codes for a protein. The uppercase letters represent exons. The...

See similar textbooks

Similar questions

Energy that drives transcription is provided mainly by _______ . a. ATP c. GTP b. RNA nucleotides d. RNA polymerase
5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription start site is bold. Transcribe template DNA to mRNA. Make sure you write mRNA in the 5’ to 3’ direction. This is tricky – don’t assume the polymerase knows right from left. It can only synthesize new DNA in 5’>3’ direction.
5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1 transcription start site is bold. Transcribe template DNA to mRNA. Make sure you write mRNA in the 5’ to 3’ direction. This is tricky – don’t assume the polymerase knows right from left. It can only synthesize new DNA in 5’3’ direction.
Inverted repeats in the DNA sequence being transcribed can lead to mRNA molecule that forms a hairpin loop and is often used terminate transcription. The transcription process supercolls DNA. the first statement is true. the second statement is false. the first statement is false. the second statement is true. Both statements are true. Both statements are false.
A gene will have a sequence of DNA in front of it that directs the RNA polymerase to where to begin tr This sequence of DNA is the . transcription promoter terminator RNA splicing
During transcription, an mRNA molecule is formed: True False inside the nucleus that is identical to part of a single strand of DNA that is complementary to both strands of DNA that it is double-stranded
Which of the following statements about the transcription process is correct? a. A protein is made from the RNA base sequence b. A protein is made from the DNA base sequence c. RNA is made complimentary to DNA d. DNA is made complimentary to RNA
What is the mRNA transcribed by the following piece of DNA? Make sure to label its directionality. Then write the sequence of the lagging strand in replication of the below strand. ATTCCGAGTCAAGAA
. In transcription, the location where RNA polymerase initially attaches to a gene is called the (a) promoter (b) intron (c) exon (d) 3’ UTR (e) 5’ UTR
Which of these is not part of transcription events Polymerase Primer Promoter Sigma factor Uracil
In which order do the following events occur in prokaryotic transcription (from 1 = first to 4 = last)? The new RNA strand detaches from the DNA template and RNA polymerase RNA is synthesized in the 5' to 3' direction RNA polymerase reaches the termination site RNA polymerase complex binds to the promoter
When he sell requires a production of the specific proteins what steps must occur The gene must undergo transcription and then codons Will be a tractive together during translation The gene was be replicated and then translated to produce RNA The gene must first be transcribed and then to our must be translated The gene must first be translated and then the RNA must be transribed