The following is a prokaryotic DNA sequence. Fill in the other strand of DNA. Be sure to label the ends appropriately (5’ and 3’). Transcription goes from left to right and stops after the right most base pair. On your DNA, indicate which is the coding/partner and which one is the template. Write out the pre-mRNA transcript. Be sure to label the ends appropriately (5’ and 3’). DNA 5’ – T G G G G G A T A C C G C A T G C A G G T A G T C T A A G C G A G T G A C – 3’ DNA mRNA

The following is a prokaryotic DNA sequence. Fill in the other strand of DNA. Be sure to label the ends appropriately (5’ and 3’). Transcription goes from left to right and stops after the right most base pair. On your DNA, indicate which is the coding/partner and which one is the template. Write out the pre-mRNA transcript. Be sure to label the ends appropriately (5’ and 3’). DNA 5’ – T G G G G G A T A C C G C A T G C A G G T A G T C T A A G C G A G T G A C – 3’ DNA mRNA

Name: The following is a prokaryotic DNA sequence.Fill in the other strand o
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The following is a prokaryotic DNA sequence.Fill in the other strand of DNA. Be sure to label the ends appropriately (5’ and 3’).Transcription goes from left to right and stops after the right most base pair. On your DNA, indicate which is the coding

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 8QP: The following segment of DNA codes for a protein. The uppercase letters represent exons. The...

See similar textbooks

Similar questions

The following is the base sequence on the coding strand of a DNA molecule. AAT GCC AGT GGT TCG CAC Rewrite the base sequence above and underneath write the base sequence for the template DNA strand. Write the base sequence for the strand of mRNA transcribed from the original strand of DNA or template strand. Remember transcribing means making mRNA from DNA. Write the amino acid sequence translated from this mRNA. Translating means making an amino acid chain from mRNA. A) If the fourth nucleotide in the coding DNA strand was changed from a G to a C, what would be the base sequence of the new strand of mRNA? b) What would the resulting amino acid fragment be? A) If a G were added to the coding DNA strand after the third nucleotide, what would be the base sequence of the resulting mRNA? B) What would the resulting amino acid fragment be?
The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Indicate the 3’ and 5’ ends of both strands. G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g a G G T T A A C G A T A T T A C C G T t t t a a c C C A G T C C G T t t a g c t G T A T C G A C T G C C c c t a c t C C A A T T 2.Write the pre-mRNA molecule. Indicate the 3’ and 5’ ends. 3. Write the mRNA molecule. Indicate the 3’ and 5’ ends 4. Write the tRNA anticodons corresponding to the codons in the mRNA. 5. Write the sequence of amino acids in the resulting polypeptide.
The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that we used last week. The mutations can be seen underlined in purple (You can use your mature RNA to skip some steps, just make sure to change the nucleotides that are marked below. With this information please answer the questions below. What is the sequence of the polypeptide that will be generated from the mature mRNA? write a "-" between each amino acid. All in caps. Write STOP for the stop codon. Example ALA-LEU-MET-ILE...
What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG ____________________________ Write the mRNA codon sequence for the following DNA sequence. CTGCACTGA ____________________________ Write the anticodon tRNA sequence for the following mRNA sequence. UACGACUAG ____________________________ Name the amino acids that use the following mRNA codons. CAU ______________________________ AUG ______________________________ AAG ______________________________ CCC ______________________________ Name the amino acids that use the following DNA codons TAT ______________________________ CGA ______________________________ List the amino acid sequence for the following mRNA code. Be sure that you start with the first start codon you get to and then proceed to list the amino acids until you get to a stop codon. CGUAUGACUGGAAUACUUUAGCCAGCU __________________________________________________________________
A gene is a piece of DNA that codes for a protein. Genes are transcribed into mRNA and are on the antisense strand of DNA. A gene contains the following nucleotide sequence: TAC GGC ACC GTA ATT If the following changes occurred in the gene, identify the type of mutation and how it would affect the protein made (amino acid) Changes: Second codon change from GGC to AGC Third adenine base changed to a guanine base Ninth nucleotide changes from C to T Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide
Which of the following mRNA codons could be changed to a stop codon by a single base pair substitution in DNA ? [In other words, if you substitute one of the bases for a diferent one, it will produce a stop codon. Don't overthink this. Just look at the codon as written, and see if changing any one base leads to a stop codon]. 1. UAC (tyrosine) 2. UGG (tryptophan) 3. CGA (arginine) 4. ACU (threonine) A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1, 2, 3 and 4 are correct
Which of the following statements most accurately describes the action of the enzyme RNA polymerase?Select one 1.) RNA polymerase will transcribe only the exons by skipping over the introns within a eukaryotic gene sequence 2.) RNA polymerase will transcribe both DNA strands, moving in the 3' to 5' direction for one strand and 5' to 3' on the other 3.) RNA polymerase will transcribe both DNA strands, but only one RNA molecule will be used during translation 4.)None of the statements accurately describe the function of RNA polymerase
If one DNA strand has the nucleotide sequence below, what is the nucleotide sequence on its complementary strand? 5’ACCGATTACGATTACG3’ If the template DNA strand has the nucleotide sequence below, what is the nucleotide sequence on mRNA? 5’ACCGATTACGATTACG3’ In the chart below, indicate the unique structural or functional characteristics of DNA and RNA, as well as their similarities. Be very specific. Unique DNA characteristics Similar characteristics Unique RNA characteristics
The following is the base sequence on the coding strand of a DNA molecule: AAT GCC AGT GGT TCG CAC Coding DNA: _________________________________________Template DNA: _________________________________________ mRNA: _________________________________________ Amino acids: _________________________________________ Mutation 1 A) Coding DNA: _________________________________________Template DNA: _________________________________________ mRNA: _________________________________________ B) amino acids: _________________________________________
You are presented with the following DNA molecule: 5’ A T G C G A T T A T A A 3’ 3’ T A C G C T A A T A T T 5’ A. Write the template DNA strand B. Transcribe the template DNA strand into mRNA C. Translate the mRNA into an amino acid sequence
mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built. It is important to understand the relationship between the following nucleic acids: DNA template and mRNA strands are (the same or complementary) DNA template and tRNA anticodon strands are (the same or complementary) DNA non-template and mRNA strands are (the same or complementary) DNA non-template and tRNA anticodon strands are (the same or complementary) DNA template and DNA non-template strands are (the same or complementary) mRNA and tRNA anticodon strands are (the same or complementary)
The coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’ 1) Find the sequence of the mRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5’ end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!