Using a diagram, and 3-5 sentences, explain the relationship between cell immortality and telomerase activity. Please help me with this! Thank you
Q: Identify the type of mutation that occurred to produce the abnormal hemoglobin. Explain why you…
A: Nonsense mutation: This is a condition in which a protein loses its function, resulting in sickness…
Q: Describe the structure of nucleosome ( please keep it short as much as you can ).
A: A nucleosome is a basic structural unit of eukaryotic chromatin . It consists of approximately 150…
Q: identify the 3' and 5' ends of the DNA segment AGTCAT
A: Deoxyribonucleic acid (DNA) is the genetic element composed of two polynucleotide chains which coil…
Q: whose properties suggest that they originated from transfer of foreign DNA into a bacterial cell.
A: The recombinant DNA technology helps to create an organism with desired genes that can be produced…
Q: Name the disease occur due to defective Nonhomologous End Joining Repair.
A: There are four phases of cell cycle G1, S, G2 and M. Most of the DNA repair occur in G1 phase of…
Q: Discuss with your teacher and find out how to distinguish between(a) Plasmid DNA and Chromosomal…
A: The genetic information of an organism is carried in its chromosomal material either be DNA or RNA…
Q: On paper, replicate the following segment of DNA: (UPLOAD PHOTO OF YOUR ANSWER) 5' ATCGG CTACGITCAC…
A: Replication is the process of making two similar DNA units from a double-stranded DNA molecule.…
Q: Describe two similarities and one difference between RNA polymerase and DNA polymerase Your answer…
A: RNA and DNA polymerase III are used in synthesizing nucleic acids . DNA polymerase has proofreading…
Q: Please use the below DNAs and complete 4 steps question. Thanks1
A: Replication : It is the biological process of producing two identical replicas of DNA from one…
Q: Please explain the full DNA synthesis process
A: DNA synthesis occurs when a cell divides, in the process known as replication. DNA replication is…
Q: Table 2. DNA Sequence 2 from Lactose-Tolerant and -Intolerant Individual Individual Phenotype…
A: Introduction:- Chromosome usually represent the long chain DNA molecules that have the genetic…
Q: DNA polymerase functions from 5’ to 3’ direction. Explain this sentence. You
A: The DNA has been unraveled and unzipped. The helical structure has been unraveled. Special chemicals…
Q: Write the name of disease occur due to Nonhomologous End Joining Repair.
A: When their is defective Function of DNA break repair , then it is known as DNA repair defect which…
Q: Amplification and cloning stepwise procedure with enzymes
A: gene cloning is a process in which involves the separation of the DNA fragment from the interested…
Q: Think about ONE possible consequence with a brief explanation if the primers were not removed after…
A: Introduction: DNA is a genetic material that defines every cell. Before a cell duplicates and is…
Q: O Bacteriophage
A: Virus is there small particles that need the host for its reproduction and prolongation.
Q: Match each enzyme name in the left column with the correct descriptive phrase in the right column.…
A: DNA replication is the biological process of producing two identical replicas of DNA from one…
Q: Which one is correct about telomeres? Choose at least one correct answer TTAGGG sequence is…
A: The distinctive structures that are found at the ends of our chromosomes and consist of the…
Q: - sequence is there an error in the DNA
A: The advent of technology has lead to discovery of structure of DNA by Watson and Crick in 1950. This…
Q: TAG, TA, and TGA are stop codor
A: 4) The 5' cap is added to the first nucleotide in the transcript during transcription. The cap is a…
Q: somatic cells and CRISPR Cas9
A: Cells are the littlest units of life, and subsequently are regularly alluded to as the "building…
Q: Enumerate the steps involved in gene cloning and the protein/enzyme requirements for each step. Just…
A: The technique of creating numerous, exact copies of a specific portion of DNA is known as DNA/gene…
Q: explain the relevance of a chi-square test in genetics
A: The branch of biological science focusing on the study of variations of genes, genes as a whole, and…
Q: Answer the following 2 questions based on the given sequence of DNA. The top strand is the template…
A: The central dogma of DNA consists of transcription and translation. In transcription, the DNA makes…
Q: Budding yeasts such as S. cerevisiae exhibit telomerase activity throughout their life cycles,…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Telomerase is a reverse transcriptase enzyme that carries its own RNA molecule (Figure 1(a)). The…
A: Telomerase is an enzyme which maintain the length of the telomeres of chromosome by adding the…
Q: There are 2 parts to this question: The following DNA strand (below) is about to undergo DNA…
A: The cellular functions are regulated/controlled by the DNA present within the nucleus of the cell.…
Q: 1. What are the materials used for the polymerase chain reaction? 2. Draw a schematic diagram of…
A: The polymerase chain reaction process is used for the amplification of desired target DNA…
Q: explain topic is about how recombinant DNA is made
A: In this method DNA from two different species is isolated and inserted into a host organism to…
Q: Enumerate and define the steps/processes involved in replication.
A: Replication is the process in which two identical copies of DNA molecules are produced from the…
Q: Table 2. DNA Sequence 2 from Lactose-Tolerant and -Intolerant Individual Individual A IV-3 Phenotype…
A: Chromosomes are the rod shaped, dark stained bodies which are most prominently seen in the metaphase…
Q: Replicate the DNA strand AAGGCTAACGGCATTTAACCC. Transcribe the DNA strand AAGGCTAACGGCATTTAACCC.…
A: In most organisms, genetic material is stored in the form of DNA. In humans, each cell's nucleus has…
Q: Telomerase is a very important enzyme for the control of both cancer and aging. In 5 sentences,…
A: The ends of the linear chromosome is known as telomere,it is rich in the tandem repeats of…
Q: What effect does the transposon have on the function of gene X in this figure?
A: Transposons are DNA segments that can migrate around in the genome of a single cell and take up…
Q: correct
A: Telomeres are present at the end of the chromosome strand and these are the repeated DNA sequences…
Q: In your own words, explain how cancer cells differ from normal cells in regard to the following:…
A: The ends of a chromosome are known as telomeres. These are regions that do not code for the DNA in…
Q: Calculate volume for 10 ug of DNA.
A: DNA concentration is estimated by measuring the absorbance of a DNA sample in a buffer solution at…
Q: Write a short note on replication of DNA.
A: DNA replication is semi-conservative and bidirectional. It occurs in S-phase of cell cycle. details…
Q: Shows a nucleosome with DNA (wire structure) wrapped around the outside. Where would you look for…
A: A nucleosome is a piece of DNA that is wrapped around a protein core. DNA creates a compound with…
Q: Match each enzyme name in the left column with the correct descriptive phrase in the right column.…
A: The biocatalysts that function to decrease the activation energy and increase the reaction rate are…
Q: Second part asks: Explain the roles two of those enzymes would play in obtaining the recombinant…
A: As the second part is asked, so we are answering question 5 only. Genetic engineering, often known…
Q: _____________ a proteomic technique that uses genetically modified yeast cells to detect…
A: A molecular biology technique is used to discover protein-protein interactions and protein-DNA…
Q: Answer the following questions. 1. List the complementary non-coding DNA sequence. This refers to…
A: The messenger RNA (mRNA) sequence is given, and we are asked to determine the complementary…
Q: Use the diagram to answer the following three questions. 5' TTAGGGITAGGGTTAG 3' || CAAUCCCAAUC…
A: (a) Write next six bases that would be added by telomerase using the format 5'NNNNNN3'…
Q: For this question please can I have sketch of a map of the pMBBS plasmid showing the relative…
A: Restriction enzymes are also called molecular scissors. These are generally employed in cutting the…
Q: Briefly explain the significance of telomerase in normal cells versus tumors and cancer cells
A: In promulgating progenitor cells deduced from labile normal stem cells as well as in embryonic stem…
Q: make a flowchart to show how DNA replication happens to identify the different enzymes needed in…
A: DNA is the genetic material in most organisms except some viruses. DNA is present as a right-handed…
Q: The steps that involve complementary base pairing is the second step in which the nucleotide is…
A: 1. DNA replication is the process by which two identical copies of the DNA template strand is…
Q: An E. coli replication fork is shown in Figure 2.2. III 3' IV 5 II Figure 2.2 (i) Circle and label…
A: DNA is a double-stranded structure that can replicate by itself. The self-replication of DNA is…
Q: Answer the following two questions. Ensure that your answer is separated into two parts, labelled A…
A: Introduction:- Eukaryotic chromosomes are made up of linear DNA with two ends, whereas prokaryotic…
Using a diagram, and 3-5 sentences, explain the relationship between cell immortality and telomerase activity.
Please help me with this! Thank you!
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- In your own words, explain how cancer cells differ from normal cells in regard to the following: Telomeres, which are products of telomerase enzymeUse the gel to answer the following questions. You will be constructing a map of the plasmid, pDiddy. What is the largest fragment size that the BamHI/NcoI double digest produces? 2.250 kb 2.500 kb 2kb 750 bPlease explain the full DNA synthesis process.
- View the given linked video to see the detailed structure of the different kinds of DNA. After analyzing make a simple illustration to relate the different kinds of DNA to its function. https://www.youtube.com/watch?v=o_-6JXLYS-kUse the gel to answer the following questions. You will be constructing a map of the plasmid, pDiddy. There are NO sites where multiple enzymes cut. How many base pairs long is the plasmid? 3kb 2kb 4kb 5kbGive only typing answer with explanation and conclusion Recombinant human insulin produced by bacteria carrying a cloned insulin gene, is now the major form of insulin used to treat diabetes. The human insulin gene encodes an mRNA only 333 nucleotides long, but the entire gene spans more than 4000 nucleotides. There are three exons and two introns 1. Every cell in the human body has the same DNA, so very cell has an insulin gene. However in order to use the technique, you described in b, you would have to start with cells from the pancreas the only body cells that actually produce the insulin protein. Why are these the only cells that would work.
- Give typing answer with explanation and conclusion What is the transcription product of the DNA templa GCTAGCGATGAC-5'? OA) CAGTAGCGATCG OB) CGAUCGCUACUG OC) CGATCGCTACUG OD) CGUTCGCUTCUGwhat is telomeraseUse the gel to answer the following questions. You will be constructing a map of the plasmid, pDiddy. IF the EcoRI/BamHI double digest produces 3 fragments with only two sizes, what are their sizes? 2.5 kb, 250 b and 250 b 3.0 kb 2.0 kb 500 b and 500 b 3.0 kb 1.0kb and 1.0 kb
- Use the gel to answer the following questions. You will be constructing a map of the plasmid, pDiddy. F the EcoRI/BamHI double digest produces 3 fragments with only two sizes, what are their sizes? 2.5 kb, 250 b and 250 b 3.0 kb 2.0 kb 500 b and 500 b 3.0 kb 1.0kb and 1.0 kb#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut: