Using the provided coding strand below: 5-ATCAGATGGCCGGGCCAATAGAATAGCTGT-3 What is the name (word) of the animal that is represented when you transform the 3-letter codes of the amino acid sequence into its 1-letter notation? Type your answer in the box below.
Q: A Section of a Gene CTA AAA TAG TCT For the DNA sequence shown above, identify the following: mRNA…
A: A biological process in which the information present in DNA is copied to RNA (mRNA) is known as…
Q: omplete what is being asked and finally with the Genetic Code table, determine what specific amino…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: For each, choose either replication, transcription, or translation. Okazaki fragment [ [ Choose ]…
A: The three main processes of central dogma of molecular biology are replication, transcription, and…
Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…
A: Protein is made up of a chain of monomeric subunits called amino acids joined together by peptide…
Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…
A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…
Q: Match the term and its description. Each term can only be used once. a series of nonoverlapping,…
A: A codon is a 3 nucleotide sequence triplet unit and each codon codes for specific amino acids. the…
Q: Create an mRNA strand based on the given DNA template strand: TACTTCCTATTTTCTTGTCA CCGCACT Using the…
A: The process of synthesis of RNA with the help of DNA is called transcription and the process of…
Q: If a polypeptide chain is 30 amino acids, how many nucleotides will make up the coding mRNA strand?…
A: Amino acids are the monomers that join together by peptide bond formed between the carboxyl end of…
Q: Using the DNA template –TACTGGGTACAAGAACA- for transcription, what is the base sequence of the mRNA…
A: The genetic code is stored in the DNA, which is coded in the messenger RNAs (mRNAs) by a process…
Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…
A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…
Q: Bacteria Eukaryotes First amino acid 5' end 3' end Cistron Introns/exons
A: Bacterial and eukaryotic m-RNA is different from each other in bacterial translation first amino…
Q: DNA 5' ATGGCTTCTCAATACTGCTTTGTTTTGGTT 3' template strand 3' TACCGAAGAGTTATGACGAAACAAAACCAA 5' coding…
A: The mRNA is produced by the process of transcription. And protein is produced by the process of…
Q: Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about…
A: Introduction: 20 amino acids make up all the proteins. These are the building blocks of proteins…
Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the…
A: Protein is the final product of a gene that determine the phenotype of the organism. Protein…
Q: Give the sequence on the opposite strand for ACGTAT, AGATCT, and ATGGTA (all read 5' to 3'). Are the…
A: Deoxyribonucleic acid (DNA) and Ribonucleic acid (RNA) are the two types of nucleic acids forming…
Q: Describe the steps (Initiation, Elongation and Termination) involved in translation of mRNA to…
A: All the living cells are made up of protein, which acts as building blocks for every organism. These…
Q: Which library would you screen if the goal was to identify the coding sequence for a protein? a.…
A: Coding sequences mean exons present in DNA. Noncoding sequences mean introns. introns are noncoding…
Q: then translate the resulting mRNA using the gentic code table below. Choose the correct sequence of…
A: The flow of genetic information in cells from DNA to messenger RNA ( mRNA) to protein is identified…
Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences:…
A: The RNA is produced from the template strand of DNA by the transcription process that occurs within…
Q: Analyze the following amino acid sequence and write down a potential mRNA sequence from which this…
A: The mRNA is "read" by the genetic code during translation that constitutes the second major stage in…
Q: If MRNA carries the code: UUU-UCG-ACU-GAU-GUU, then what is the corresponding code on the coding…
A: The mRNA or the messenger RNA is transcribed from the antisense or non-coding strand of the DNA as a…
Q: create a summary of the nucleotide pairs during the translation process
A: Answer: Introduction: Translation process occurs in ribosomes of cytosol or membrane of the…
Q: Use the genetic code table to determine the amino acid sequence of the given message strand of DNA…
A: Proteins are made up of amino acids, which are a type of molecule. The basic components of life are…
Q: Below is a polinucleotide sequence of the non-template strand of a coding DNA sequence. Use the info…
A: Central dogma of molecular biology: It states that the DNA which contains the genes are…
Q: Describe how proteins are sequenced, and explain why sequence determination is important
A: Protein sequencing is the technique to determine the amino acid sequence of a protein. Proteins are…
Q: Suppose that section x, y, and z of the following hypothetical DNA strand are the exon (coding…
A: Exons and introns are nucleotide sequences within a gene. Exons are the coding sections of a gene…
Q: Use the table to answer: A portion of an mRNA attached to a ribosome reads: 5′…
A: Ribosomes (macromolecular structure) composed of rRNA and polypeptide chains are formed of two…
Q: How many bases would a mRNA have? if it was coded for a protein of 250 amino acids long? explain…
A: The flow of genetic information in a biological system is explained by central dogma and it involves…
Q: Use the following DNA sequence, and write the resulting messenger RNA sequence
A: When DNA makes it's two copies then this is called replication. When DNA is converted into RNA then…
Q: DNA strand (5'-3' or 3' to 5'), a mRNA, or a set of tRNAs, know how to deduce the other sequences…
A: The central dogma of molecular biology states that in a cell, the nucleic acid or DNA will undergo…
Q: For the mRNA strand above, use the codons and the diagram below to determine what amino acids will…
A: mRNA sequence: UAC AUG GCC UUA CGC UAA tRNA sequence : AUG UAC CGG AAU GCG AUU
Q: Give two examples of places you could have mutations in the DNA sequence of a eukaryotic gene that…
A: The change in the heritable characteristics of the species across many generations is called…
Q: Carries a protein-building message select answer Transports and delivers specific amino acids to…
A: mRNA is the type of RNA that carries a protein building message. It is transcribed from DNA. It is…
Q: The MRNA produced when the following sense strand DNA sequence is transcribed is: 5'-…
A: The transcription unit is the segment of DNA that takes part in transcription. It is studied under…
Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…
A: DNA is a double stranded helical structure present inside the nucleus. It acts as a hereditary…
Q: A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following…
A: The above given statement is about protein and amino acids and their codons.
Q: ’. Envision that each is a section of a DNA molecule that has separated in preparation for…
A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…
Q: Use Table 1 to read the codons below. Find the name of the amino acid and write it in the space…
A: b) UUA: Leucine c) GAG: Glutamate d) UAU CUA: Tyrosine-Leucine e) AUC UUG: Isoleucine-Leucine
Q: Create protein sequence with 10 elements. (Start with a codon and ends with a stop codon)
A: Protein sequencing is the cycle of deciding the amino acid arrangement of all or part of a protein…
Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…
A: Introduction According to Chargaff's rules, DNA from any cell of any organism should have a 1:1…
Q: A Section of a Gene TGC GTG TAC CTA CCA For the DNA sequence shown above, identify the following:…
A: The given DNA sequence is as follows, TGC GTG TAC CTA CCA
Q: Analyze the following amino acid sequence and write down a potential mRNA sequence from which this…
A: The translation is a process by which ribosomes in the endoplasmic reticulum synthesize proteins…
Q: What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG…
A: DNA is genetic material which is involved in transfer of information into the protein. It involves…
Q: If MRNA has the bases UAU, what is the matching tRNA? O UAU O ATA O TUT O AUA
A: DNA(deoxyribonucleic acid) is the genetic material in all organisms except few viruses. The genetic…
Q: Name and describe two important functions of eukaryotic DNA that do not code for protein.
A: 1. DNA ebilibity to code molecules like ribozymes (RNA which has ebility to catalyze biometabolic…
Q: Which amino acid would be attached to a tRNA that read "GGU"?
A: Introduction : A codon is defined as a sequence of three nucleotides which together form a unit of…
Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3' , what is the…
A: The genetic code is the set of rules used for translation of the information encoded within genetic…
Q: If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the…
A: DNA strand – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…
Q: DNA TAC - GGC - GAA - TCC - CCA - GTA - TCC - ATT ТСС - ТСС - АTT (gene) MRNA AUG Amino Acid Met…
A: DNA => Transcription => mRNA => Translation => Protein Transcription: Formation of RNA…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- If the genetic code used 4 bases at a time, how many amino acids could be encoded?Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence.Refer to a genetic code table for the question. below is a portion of the template strand of a particular gene sequence. Which of the following would be the correct sequence of amino acids in the protein that this portion of the gene encodes? (Note that there are no entrance in this gene sequence, and this portion is found in the middle of the coding sequence, past the start codon, so you should transcribe and translate the entire portion of this sequence) template DNA : 3' - ACG GGT TCC TTT AAC GCG TAG -5' A) Thr-Gly-Ser-Phe-Asn-Ala B) Cys-Pro-Arg-Lys-Leu-Arg-Ile C) there is not enough information given to determine the amino acid sequence of this portion of the gene .
- Part of the protein-coding region in a gene has the base sequence 3- TACCGCAGCATAACGTTCGCAATCTACCGCTCCACCGGGTC-5'. What is the sequence of the partner DNA strand?Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.Give typing answer with explanation and conclusion Which of the triplets below is a possible anticodon for a tRNA that transports proline to a ribosome? Use your genetic code. Group of answer choices 3′-UUC-5′ 3′-CCG-5′ 3′-GGC-5′ 3′-CCC-5′
- Use the genetic code table to determine the amino acid sequence of the given message strand of DNA below, from N to C terminal. All introns were removed in this sequence for simplicity. Write the amino acids in their 3-letter abbreviation and separate with a dash.Give typing answer with explanation and conclusion What is a codon?For the mRNA strand above, use the codons and the diagram below to determine what amino acids will be brought by the tRNA and the order that they will bond together.
- Using the figure below identify: What is a function of introns and exons? What is a role of mobile DNA elements? What is a meaning of simple-sequence DNA?Give typing answer with explanation and conclusion to all parts Consider the following DNA mRNA sequence: 5’-ACTGATCCATGCCAGGGGTTTTCAACTAAAATGAAA-3’ a) What is the template sequence this mRNA was transcribed from? Include 5’ and 3’ labels. b) Based on this sequence, what you predict would be the resulting peptide sequence from it. c) In examining this sequence what is the proper reading frame of the open reading frame? (+1, +2, +3, -1, -2, or -3). d) What would you predict the peptide sequence to be if there was the following mutation that led to a base change: 5’-ACTGATGCATGCCAGGGGTTTTCAACTAAAATGAAA-3’Consider the following DNA sequence:CATGTGTAGTCTAAAa. Write the sequence of the DNA strand that would be repli-cated from this one.b. Write the sequence of the RNA molecule that would betranscribed from the DNA strand.c. State how many codons the sequence specifies.d. State how many amino acids the sequence specifies