Which area represents the region important for transformant growth on selection plates (e.g. growthon antibiotics)?Origin regionArabinose operonoriNdelaracPromoter PeADPGLO(5,400bp)NdelAmpicillinResistance GeneAmpHindlllNdelGreen FluorescentProtein (GFP) GeneHindil'ECORIfraphicoE.Schmid/2003DO AOBOCOD You performed an experiment where you want to introduce a new gene into bacteria using the pGLOmolecule. You prepared your positive and negative controls with the appropriate reagents so thatyou could compare your experimental plate. What type of plate is B (what ingredients are plate B)?Lb - Lysogeny broth, Luria broth, Lennox broth, LB Agar or Luria-Bertani medium (nutrients forbacteria)Amp AmpicillinAra - arabinose-PGLO• PGLOCLB/ampO LBO LB/AmpO LB/Amp/Ara

There are different rDNA (recombinant DNA) technologies used for various purposes. rDNA technology…

Which area represents the region important for transformant growth on selection plates (e.g. growth on antibiotics)? C Origin region ori Arabinose operon arac Ndel Promoter PaaD PGLO (5,400bp) Ndel Ampicillin Resistance Gene Amp Hindll Ndel Green Fluorescent Protein (GFP) Gene Hindll GraphicOESchmid/2003 D O A O B OD

Which area represents the region important for transformant growth on selection plates (e.g. growth on antibiotics)? C Origin region ori Arabinose operon arac Ndel Promoter PaaD PGLO (5,400bp) Ndel Ampicillin Resistance Gene Amp Hindll Ndel Green Fluorescent Protein (GFP) Gene Hindll GraphicOESchmid/2003 D O A O B OD

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Similar questions

esting 8MU376MpwkNtkrF5%252B26BVPP%252Bzg%253D%2. Question Image 1 3 6. 7. 8. with the figure? cracteristics ight differe dividuals can compared Q. Which of following can you do with the biotechnology depicted in the figure? • 0 1:47 Sign out || O|| | 11
A amp PBR322 4301 fot B Clear Zones Figure 2 The postgraduate student, Demika, inserted her gene of interest into the plasmid, pBR322, before transformation into the competent host cell using heat shock method. After that she cultured the cells on the Ampicillin agar plate before replica plating the colonies onto another Ampicillin (A) and Tetracycline (B) agar plates shown in Figure 2. (1) Referring to the vector pBR322 in Figure 2, which recognition site was cleaved to insert the gene of interest? Based on the observation above, can you identify which colonies are carrying positive mcombinants of BR322? Explain your selection.
Gel electrophoresis separates molecules based on size O charge O weight What is the restriction cut site for HaellR ATAT GGCC O AATTAA O CGGGC
which of the following 's lave thue about RT-apcR? a) Floure scent chemiical is added in the Process and the fluorescent fignal is detceled only over once at last pce y ce The most important features. that eference have shold all samples is steple expression gene in The amount of template sequence Can se C) original Sample quanti fied in RT-9pcR the D: ff. re feren ce gee4.valuy Ca in tes ting fefertnce fample voiafio2 amouts iu the are due to fficien cy of CONA ryn they's. ae
Synthetic polylinker Hindill EcoRI sticky end 5 AATTCCTGCAGAAGCTTCCGGATCCCCGGG CITAA Plasmid cloning vector (cleaved with Eco) GGACGTCTTCGAAG GCC TAGGGG CCCTTAA AATTC Psti Hindi Nelson & Co, Leninger Principles of Biochemistryde ©2021 WH Freeman & Company BamHI Smal EcoRI sticky end Enzyme Polylinker transferase; 2 ligase; 6 lyase; 6 lyase; 4 ligase; 4 BamHi Smal CITAAG GRATT C EcoRI Which pairing correctly matches the enzyme class and Enzyme Commission number for the enzyme that catalyzes this reaction?
2 3 inte tion of Lormhda. ne att si ucated betwee de ne att sites and go ns one te n vacter aged ot utilize doot ractose ato la t don s gal* uc Integration to form prophage om SOward cor coct some cro on! ni imple ex 2 3 bio* gal* 14. The figure provided portrays the integration of Lambda phage into a host chromosome at the att site, located between the gal+ and bio+ genes. This prophage may disintegrate from the host carrying with it host genes, such as gal+ and/or bio+ and go on to transduce another host bacterium. How would one determine if a gal- host bacterium's phenotype was changed from gal- to gal+? To clarify, the minus version cannot utilize galactose as a carbon source for growth because it does not produce galactase, the enzyme that hydrolyzes galactose into monomeric sugars. There is a straight forward answer/solution to this – do not concoct some crazy solution! Think simple experiment.
Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI
che World Mona L A Leonardo da Vinci Museum - Flo x dSequenceViewer/14003927urlahttps%3A%2F%2F43160dd0-1a11-43d1-b28d-96e9e2abb6d2.sequences.api.brightspace.com2F1400392%2Factivity2217 1.07 Quiz: Experimentation UIZ: Experimentation Kate gathered three boxes of the same size made of different materials glass, clear plastic, and aluminum painted black She placed them on a window sill in the sun for an hour and then measured the warmth of the air in each box In this experiment, what is the warmth of the air? O an independent variable O a control O a constant O a dependent variable 2 3 45 Next
Define/Compare/Contrast/Distinguish these three terms: F plasmid F’ plasmid (and how is it formed) Hfr cell (and how is it formed)
Section B: Circular DNA Plasmid map Eco01091 2674 Pfol 46 BSTAPI 179 Aatil 2617 Ndel 183 Sspl 2501 Ehel 235 Pdml 2294 146/ 236 lacz Bcgl 2215 Scal 2177 \2486 MCS 469 PUC18/19 2686 bp BsaXI 659 Sapl 683 852 AflI, Pscl 806 Gsul 1784 1626 Cfr101 1779. Eco311 1766 Eam11051 1694 1466 Гер (pMB1) BseYl 1110 \Cail 1217 Ed Acs CCT CCA GGT CGA CrC TAG AGG ATC CC GGG TAC CGA CCT CGA ATT CT MT CAT G07 CAT AGC TGT 7C CtG 3 ITA OTA CCA GTA TCI ACA ANG GC Y 3 C ATT TO Crs cOG Lacz Val Val Al Leu Ass The e et Thr Met 1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp, What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. a. Pscl & Gsul b. Scal, Pdml & BsaXI c. Scal, Sspl & Ehel 2. You have determined that the amplicon you want to clone has enzyme restriction sites for Hindll and ECORI, After investigation you have seen that…
Asap
Three pairs of bacterial cells with the given genotypes undergo conjugation. Place match the genotype of each cell after conjugation to its initial genotype. F+ x F Hfr F- F' F- Answer Bank F F F+ Hfr What is the role of the F-factor in conjugation? It contains genes necessary for replication of the donor's F plasmid. can occur. It allows auxotrophic bacterial cells to survive on minimal medium so that conjugation It contains genes that force recombination between the donor and recipient chromosomes. It contains genes necessary for the formation of the pilus. O It degrades the chromosome of the recipient cell after conjugation.