Which of the following statements about PCR or RT-qPCR is correct? 1. Fluorescence is detected when the TaqMan probe is cleaved by Taq polymerase (AMPLITAQ). 2. PCR uses the natural process of transcription to amplify DNA. 3. Both PCR and RT-qPCR require forward and reverse primers. 4. Fluorescence is detected when the reporter dye is in close proximity to the quencher dye. O A. 1, 2 and 3 O B. 1 and 3 O C. 2 and 4 D. 4 only OE. All of 1, 2, 3 and 4 are correct

Which of the following statements about PCR or RT-qPCR is correct? 1. Fluorescence is detected when the TaqMan probe is cleaved by Taq polymerase (AMPLITAQ). 2. PCR uses the natural process of transcription to amplify DNA. 3. Both PCR and RT-qPCR require forward and reverse primers. 4. Fluorescence is detected when the reporter dye is in close proximity to the quencher dye. O A. 1, 2 and 3 O B. 1 and 3 O C. 2 and 4 D. 4 only OE. All of 1, 2, 3 and 4 are correct

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 10SQ

See similar textbooks

Similar questions

Which of the following is necessary for a PCR reaction to proceed? a) the sequence of the ends of the DNA to be amplified must be known. b) the sequence of restriction endonuclease recognition sites in the DNA to be amplified and in the plasmid, where the amplified DNA fragment will be cloned must be known. c) The complete sequence of the DNA to be amplified must be known. d) The sequence of restriction endonuclease recognition sites in the DNA to be amplified must be known
Explain why a positive control and negative control are included in PCR experiments. Explain the three steps involved in each cycle of polymerase chain reaction.Why is loading dye added to the DNA sample for gel electrophoresis? Explain the function of the following components in a PCR reaction:− Primer, dNTP, MgCl, Taq polymerase, buffer.
A student carries out PCR using the following steps: step 1: 94C for 1 minuteStep 2: 60C for 30seconds Step 3: 72C for 30 seconds The student is examining a 1000-bp DNA fragment as part of their research project. If the limit of detection of this molecule 9 x 108 molecules, what is the minimum number of PCR cycles you would have to run to detect PCR product generated from a single molecule of the template? 2. Two double-stranded fragments of DNA are exactly the same length. At 89 C, fragment A has completely denatured which means the two strands have separated. At that temperature, fragment B is still double-stranded. How might these fragments differ to result in different denaturation temperatures?
Which of the following best describes the complete sequence of steps occurring during every cycle of PCR? I-The primers hybridize to the target DNA. II-The mixture is heated to a high temperature to denature the double stranded target DNA. III-Fresh DNA polymerase is added. IV-DNA polymerase extends the primers to make a copy of the target DNA. A) II, I, IV. B) I, III, II, IV. C) III, IV, I, II. D) III, IV, II. E) II, III, IV.
Most PCR reactions do not use the more expensive types of DNA polymerase, which have DNA proofreading. How might this be a problem in accurately copying specific DNA sequences of the target gene?
After four cycles of PCR, which type of PCR product predominates? Explain why.
Which of the following describes an advantage of using a recombinant plasmid for DNA cloning over PCR? A. PCR is more likely to have errors introduced in the copying process. B. Recombinant DNA plasmids are able to create large amounts of copies more quickly than PCR. C. PCR can only be conducted in eukaryotic cells. D. PCR requires prior knowledge of the sequence in question, while a recombinant plasmid does not.
Put the steps of one PCR cycle in the correct order: The PCR reaction mixture is heated to about 70 degrees, which is the optimum temperature for the polymerase to build the new strands of DNA, starting at the 3' end of the primer. The PCR reaction mixture is heated to 95 degrees Celsius, which denatures the double stranded template DNA. The PCR reaction mixture is cooled to about 50-55 degrees, which allows the primers to find their complementary site on the template and "anneal" the
CGATTGCAGGTTATAGCG. Which of the following primer pair can be used to amplify this template with PCR? a. GCTAA and TAGCG b. GCTAA and CGCTA c. CGATT and TAGCG d: CGATT and CGCTA
In a typical PCR reaction, describe what is happening in stages occurring at temperature ranges (a) 92–95°C, (b) 45–65°C, and (c) 65–75°C.
Which of the following is true for nested PCR? 1. In the second round of PCR, primers should anneal only to the target site 2. Two primers are used to ensure that one or the other will anneal. 3. Both primers anneal only to the target site, the second round is to get more DNA 4. In the first round of PCR, primers should only anneal to the target site
The answer is option A In the PCR amplification, two primers are used to flank the target region to amplification. The two primers are forward primer and reverse primer. The forward primer binds to the template DNA and the reverse primer binds to the complementary strand. Step 2 In the above question, the two sequences of 21bp primers in the 5' to 3' Orientation that allows amplifying the given gene sequence are : ATGTTTGTTTTTCTTGTTTTA and GTCAAATTACATTACACATAA CAN YOU FURTHER EXPLAIN WHY IT IS "GTCAAATTACATTACACATAA," I don't understand why it's called reverse primer? and where exactly it is binding to on the strand? (A picture would really help)