Template DNA Region of interest that will be copied Cycle 4 Mix together template DNA, present in low amounts, and 2 primers, present in high amounts, with DNTPS and Taq polymerase. During each cycle, the DNA strands are separated via heating. Cycle 1 The temperature is then lowered to allow the primers to bind, and a complementary strand is made. Cycle 2 Cycle 3 With each successive cycle, the relative amount of this type of DNA fragment increases. Therefore, after many cycles, the vast majority of DNA fragments contain only the region that is flanked by the 2 primers. FIGURE 21.6 The technique of PCR carried out for four cycles. During each cycle, oligonucleotides (green) that are comple- mentary to the ends of the targeted DNA sequence bind to the DNA and act as primers for the synthesis of this DNA region. Note: The original DNA strands are purple, and those strands made during the first, second, third, and fourth cycles are blue, red, gray, and orange, respectively. ONLINE ANIMATION

Template DNA Region of interest that will be copied Cycle 4 Mix together template DNA, present in low amounts, and 2 primers, present in high amounts, with DNTPS and Taq polymerase. During each cycle, the DNA strands are separated via heating. Cycle 1 The temperature is then lowered to allow the primers to bind, and a complementary strand is made. Cycle 2 Cycle 3 With each successive cycle, the relative amount of this type of DNA fragment increases. Therefore, after many cycles, the vast majority of DNA fragments contain only the region that is flanked by the 2 primers. FIGURE 21.6 The technique of PCR carried out for four cycles. During each cycle, oligonucleotides (green) that are comple- mentary to the ends of the targeted DNA sequence bind to the DNA and act as primers for the synthesis of this DNA region. Note: The original DNA strands are purple, and those strands made during the first, second, third, and fourth cycles are blue, red, gray, and orange, respectively. ONLINE ANIMATION

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG−OH Match the items in the left column to the appropriate blanks in the sentence on the right.
Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands ofnucleotides at a moving fork. How is this additionaccomplished?
Polymerases usually add only about 10 nucleotides to a DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands of nucleotides at a moving fork. How is this addition accomplished?
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Which end of the DNA template is 5′ and which end is 3′?
Polymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication process, DNA pol III can add tens of thousands of nucleotides at a moving fork. How this additionaccomplished?
Select the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer adds nucleotides to 3' end of DNA strand adds nucleotides to 5' end of DNA strand does not require primer has 3'-to-5' exonuclease activity that allows "proofreading" of DNA strand being made
What does it mean to say thhat extension by DNA polymerase III proceed 5'---3'? A. The 5' end of a DNA polymerase molecule attaches to the 3' end of primase. B. DNA polymerase adds nucleotides to a growing strand, moving in the 5' to 3' direction. C. DNA polymerase seals nicks as it moves along a DNA strand toward the 3' end. D. DNA polymerase can only synthesize DNA at the 5' end of an existing strand of DNA.
RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
Strand directed mismatch repair corrects copying erros based on which ones apply to sentence above? a. the strand containg breaks in the sugar backbone of the replicated DNA b. structurral instabilities created between oncorrect base pairing and associated histone proteins c. mutations that are evolutionary beneficial to an organims and recults in these areas of the genetic code to be turned off d. methylation of adenosine in GATC sequences during bacterial DNA replication e. repair sequence motifs that attract DNA polymerase gamma
1c) During DNA replication, both positive and negative supercoiling is introduced in the DNA being replicated. Name the enzymes that introduce supercoiling into DNA during replication; please clearly indicate which enzyme(s) introduce positive supercoiling and which enzyme(s) introduce negative supercoiling.
During eukaryotic DNA replication, _________ synthesizes short RNA primers. The primers provide a 3'-OH group to which DNA nucleotides are be added by DNA polymerase. DNA gyrase (topoisomerase) DNA helicase DNA ligase primase
Using the plasmid map of pBCH2.0 calculate the length of the shortest DNA fragment if this plasmid was digested with the restriction enzymes PstI and EcoRV.